GenePrediction:GLEAN_3767 Details

Name: GLEAN_3767
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:796557..797469 (+ strand)
Length: 913
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:796557..796776 (+ strand)
Length: 220
Type: CDS
Source: GLEAN
Position: GCSC_113:796862..797469 (+ strand)
Length: 608
>GLEAN_3767 class=GenePrediction position=GCSC_113:796557..797469 (+ strand)
ATGGGGTCTCTACGGTCAATTGCGAGCCGACCGGCGGCACAACTGGCACGAGCAGCTCGCCCGGGTGTAGGGGTACCGCT
GGCCGCTTATGGCCGCGCTTTTTCGGTTCTGAACCGGCCGCCACCGGAATACGAAGGCCATGTTCCCTTGACGCTGGTCG
AGAAGGCGGCCCTGACGGTCGGCTCTGCCCTTGGAGCCTTTATTGATCCCTATAGGGCAGGTGAGCGTTGAAAGCCTCGA
AGCGGCTCTGCTGTCTCGCCCGTGGACGTTTTCTTTACTGATGGCGCATGTGTCATTCCCCCCAGATCTGATTGCGACCC
TGGGCGAGGTCTCGGCAGGTCCGGTGGCTCGGCAGCTCCGCGACACGATGCTCAGCGACGAGACGGGCCGGCAGATTCTG
CGTGAGCGGCCGCGCATCACGTCCGAGACGCTGCCGCTGGACGAGCTCCTGGCGTTGCCCGAAAACACCGTCGGCCGCGT
GTACGGCGAGTTTCGGCGGCGGTACCACATCTCGCCCGACGTGCGCGACAAAGTCCGATACGTGGACAATGCCGAGTGCG
CTTACGTGATCCAGCGCTACCGCGAGTGCCACGACTTTTACCACGCCGTGCTCGGGCTGCCGCCGCAGTACGTTGAGGGC
GAGATCGCACTCAAGGCGTTTGAATTTGTCAACACCGGCTTGCCCATGACCGCGCTCAGCCTTGTCGCGGTAGCTCGCCT
CAAACCCGCCGAGCGCAAGCGCTTCTTCAGCATCTTCCTGCCCTGGGCCCTACGCAGCGCCCGCAAGTCCAAGCCCATCA
TCAACGTGTACTGGGAAAAAGAGCTGCGGACAGACGCCGCCGATCTGCGCGCCCGGCTCGGGCTTGAGAAGCCGCCAAAT
TTGCATACACTCCGCAAGAAGCCAAAGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62