GenePrediction:GLEAN_376 Details

Name: GLEAN_376
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1386067..1387446 (+ strand)
Length: 1380
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1386067..1386237 (+ strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_167:1386418..1386815 (+ strand)
Length: 398
Type: CDS
Source: GLEAN
Position: GCSC_167:1386882..1387446 (+ strand)
Length: 565
>GLEAN_376 class=GenePrediction position=GCSC_167:1386067..1387446 (+ strand)
ATGTCCTCACCAAATATTACACCGCGGCACTCGCGGCGGTCCACCATGGACTACTCGCCACAAGACCGGCGGAACTCCAA
GTCGTCCTCTGTCCAGGACCCCTCCACGCCCTCCCACGAGTCGCGTCCGTCGTTTGGCAACAGTGATGGCCTGGACGTGT
TCAGCAGCAGCGTGGGTGCAGGCGGCGACGGCGGCGGCGGCGGGATGGGGCTGGGCAATCTGGCGGACGAGCTGGCGGAT
GCGCTCTCCGACGGCGAAGACGACGATATCGAGGGTGACGAGGAGTACTACGACAACGAGGCTCCGGCGCACGATGACGG
CGCTGTACCGCCCGACATCAACCTGTCAGAGGCGGCGTGGGACGACGAAGACGCGGGAGATCGAGAGGGAGGCGGCGGGC
AGCGCGACAGCGGCGTCGACATAGCACTGGCATCCAGCCCTGGAGCGCAGCGGACAAGGAACACGAGCCTCGACCTGCCG
ACAGCCAACGGAAGCGGCAACGCACGGGGTCGACACCACGGCCACCACAAGCGCAGCAGCGTCTACGACGGCTCAGAGTA
CGGCTCAGACTCGGATCTAGACACGCCGGGCATGCCGCCCAGCCTGGTGGCCAAGATGGATGCCGTCGAGTCGTTGGCAC
GACGCGGGACAGAGGAGAACGGCGGGCCGAGCGACGGCGTCTGCCGGCGTCTGATCGAGGAGCTGCGCGACCTGGGATCG
CAGGCAAACATTGAGGGAGGAGCATCGAGGTAGGTGCTGTGCTGGAGAGAGACAATTACGAGATGTGCCGATGTGCAGGT
TTGCTGACGGTCCAGACTGATCACGGCCCACTCCGCTCTGACGACACATCTGGCACACCAGACACGACAGCTGCACGCGC
TGGCGTTCCCTCTCTTTTCGCCGCTGGCCGTGTCGCCACTGATGACAGTAGGGGGTGGCGGCGGTGCTGACGGTGACGAC
GGCGACGACGACGAGGAAGACAAGGACTCGCTGTCGCCGATGCTGACGGCGCTGGCCGACCAGATGCCACGGCCCAGCAC
GGCGGCATACCAGTCGCTGGCGGCGCTGCACGGGCTGACAGGCGACCTCGTGGCGACGCTCAACTACCTGTCGGACACGC
TGCACATGGCACGACAGACGACGACGACGGCGACACGGCGACTGCGCAGCGCCAAAGAGCTGGTGGCCGAGATGCGGCGC
GACGAGGAGCTGCGGGAAGAGGGCGAGCGATGGCTGGCCCGCGGCAACTGGGACGAGCGGCTGCGACGGCGCGAGTGCGC
CCACGTCTGCGGCGAGGTTGTCGGCGGCTTTGAGGAGGTCTGCAACGGCTGGCGGGCGCGGCTGCTGGCCCAAGCAGAGG
CGGCGCAGGCGTCCGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62