GenePrediction:GLEAN_3770 Details

Name: GLEAN_3770
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:809016..810403 (+ strand)
Length: 1388
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:809016..809189 (+ strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_113:809284..809737 (+ strand)
Length: 454
Type: CDS
Source: GLEAN
Position: GCSC_113:809814..810403 (+ strand)
Length: 590
>GLEAN_3770 class=GenePrediction position=GCSC_113:809016..810403 (+ strand)
ATGAAGTCGTCAGCAGTTATCATCTCGCTCATCAGCATAGTTCTCGCTGACGCAGTCACCGACATCATCGCACCAACGGG
CTCATATCCATCTGGCTGCAGCAAGGATTTCTCTGGCGAGTTCGAGCTTTCTGTCAGCGCCGTGTCCTACGACAAGCGTG
ATCTCAAGGTCAAGGTATGTCGTCAACACAACTCCCCAACACCCTTTGATATATGCCATTTCTCTCCTTCAAGTGAATCT
CTACTGGACAGAGTCTAACTATTCTCAGAAGCGCACCTCCACGTCTTGCGGCGCCGATGGAATCCTCCTCGTGAGCCTGG
CTGATGGTGTCCTAATTGATTCCAAGAACCGGACTGGTTACATTGCCTCCAACTACCAGTTCCAGTTCGACGACCCGCCA
CAGGATGGTGCTATCTACACGGCAGGCTTTTCCGTCTGTAACAACGAGTCGCTGGCACTGGGCGCTACCACCACGTTCTG
GGAATGCGCGTCGGGTAGCTTCTGGAACCTCTACGACCGTGACTGGGCTGCCCAGTGCAGCGAGATTCAGCTGATTGTCC
TACCCTGCGATGGCAGTTCAGACAGTGAGGCCAGTGAGAGTAGCGACGGCCAGGTTGTCGCCACTTCTCAAATTACCACT
ACCGTTGTCAAGTCCATCTCGGATGGACAGGCTCAGGTTATCACAACCACTGTTGGAGTTCCTCTTTGCCAGATTACCGA
CGGTATGTTTTGTGATGAGTTCAACACCCCCACGACTCTGCTACCAGTCATGTGCTTTTGCTGATTACCCTTTTCCAGGC
CAGGCTCAGGTCCAGACCACCCCGTGCGCGGCGATTACGACCACGGCAGAAGCCACTGCGGTGCCCATCAGCCAATACTC
TGATGGCCAGATCCAGGTCACCACACCCGCAACCGCAGCCACGACTGTGGTCGCTTCCGCGACCACTACGCCGGCTTCTG
CTGAGACCACTGAGACTGCTGAGACCAGTGCTACCCCTGAAGAGACCACTGCCACCCCCGTGGAGACCACTTCCACTCCC
GAAGAGACTGGTTATACCACCGAGGAGACCACTAGTGTCGCCGAGGAAACCACTTATGCTGCGGTCACTACCCCCGTTGT
TGCGGGTACCACTACTGCCGTTGGCACTACCACTGCCAACAACTCGTACACTGCTTCCCTGACACCATCGGCATCGGCCA
ACGGCACGTTCGTGTCCAGCAAGATTTCTTCAAAGGCATCTACTGCTGCCTCTGGTACAACTGCCGGCACGACTACTAGT
GCGGCTACGGCATCAACTACCGCTGTCACAAGCGACTCTCTTCGGATTAGTGTGAGCTCGTTTGCCATTGTGGCCATCGG
TTTGCTCGGTGCATTTGTGTCTCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62