GenePrediction:GLEAN_3772 Details

Name: GLEAN_3772
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:813925..816036 (+ strand)
Length: 2112
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:813925..814143 (+ strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_113:814198..814251 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_113:814332..814641 (+ strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_113:814724..816036 (+ strand)
Length: 1313
>GLEAN_3772 class=GenePrediction position=GCSC_113:813925..816036 (+ strand)
ATGTCCTGGAAGTCCCAGATCGTGCTGTCGGTGATGGTTTTTGCTAACGATCTAAATGAACAGGCCTTCAAGGACCAGAT
GCTGCGGCTGGATAAGGACTACCGCGATGTGTGTCAAGAGCTTGCAAAAGAGCGTGCAGCAAAGCAATCGATCCAAGACA
AGTCGAAACATCAGATAAAGACGCTGGAAGCAACGGTGGCGGCACACGACAAGGCTGTGGTATGTGAGAGCCACCCGACG
AAGGATCGTTGCATAGGGCTAACGGCAAGGCAGCGCGACGGCTCGTTTGTGCTCGTATTGGTGGATGCCGACGGTGACGA
CTATCTTGTGAGCATTCAATACCTCATTCGATGTCATGTTTTCGCGTCTGCCCGTTTTCTGACCGTTGATACCTGCACGC
CTTCCAGATGAACAACTACCTGCAGCAGCAAAACGCCGTTGAGGGCGGCAGTAAAGCGGCTAAGGATCTTCGAGAGGCCG
TCAGACAGCATCTGCTGATGATGTACGGGGAGCAGGCAGCCGGTCTTCCGGTGATCGCAAAGGCATTTGCGTCAGGCCAC
GGCCGGATCAACGTGCTGGAGCGGACGACGGGAATGAAGCGGTACGACGCCCAGAAGACGTTTCTGAACTTCATGGCAGG
CTTCTCGCAGACCGAAGAGCTTTTTGACTTTGTCGTCGTCGACAGGGGAAAAGAGCGTGCCGACCGGAAGCTCGAGGGTG
AGTTCAGCTTGCCGATATGGCTCTCTTGGCATTCCTTTTTCTTGGCTGACCGTTTCTTTCTCCCCATTGCTTGTCACAGC
TTCATTCCGCCAGTTTGTCAATAACCCTTGCTGCCAGCACATCCTGCTGGCCTGCTGCCACGACAACGGCTACGTGCGCA
TGCTGGAGAAGTTTGTTGGCGATCCTGTGGCCAGCAAGAAGATTGTGCTCGTCAAGTCGTCTCAGCCGGGCGCCGAGTTT
GCTTCTCTGCCCTTTTCGTCCACCACCCTGGCCGGCTTCTTCATCCAGCGCCCGAAGCGCCCGCCCTCCCCCAAGTTTCC
GAAAACCATCCCGATTGTGGTCCCGTCGTCAGGCCAAGGCCGGACTTGGAAAGTCGCTTCGTCTGTGACCAATGCTCCGA
CTGCGTCTCCGACCCTGACTCCGTCATCCGAACAGTTCCGAACGTGGCTGGCTGCTTCGGCCGTTGTCACGGCTCCGTCT
GCGGTCGCGGCGACTTTGTCCGTGCCCAACAAGTCTGCCCCTCCCTCTCCGCTTGCTGGTCCGCCCGAGTCTCCTGGCCA
GGTAGAGCCGAAGAAGAAGTCTCCTTGGTGGCTGTCTGGTCTCCTAGGCCTCTCGTCTGGAATTCCTGAGAAGACAGAAA
CAGGCTCGGCCGCTCCTTCCATTTCGGTTCCTGACCCAACATCTATTGCAAATCCTCAATCTAAGACTACTTCCGTTCCA
GATTCCGTTCCAGCATCCGTTCCAGCACCCGTTCCAGCACCCGTTCCAGTTCCTGTGGTCTCCAAGCCTATTGTCCGGCT
GCCAGTTCGTGCGGCTGCATCAAAGCCTCCACAGTCCCGATCGTCTTCACCGCCAGCCAACAACCTTCCGTGGACACCAC
CGGCTACACCGCCGTCGCAGAGGGTCAAGCCGAGGACGCCGTCTCCTGGGTCCAGGTCTCAGTCTTCTACCGGGTCAGCC
GGGTCAACCGGGTCAAAAGCGAAAGCAAAAACAGTGCCAGAGTTTGGCATGTTTTCCGAGAATGCCGTGCTGGTGAACAC
GCAAAACCAGCGTATTGACGTGCCTCTGCCACGGAACTCGGACCCGGTGCACGAGTCGTTGCCAAAGAAGCCGACCATGC
ACAAAAAGGTCTGTCACCAGTACCAGCTACAGTCGACCTGTTTCCGACCCAACTGCCAGTACTCACACGTCAAGCTTTCG
GCCGGCGAGCTGTTGTCTCTTCGGCGCGAGCTACGTGCCAAAAAGTGCGCCAAAGAGTCTGCCTGTCGCAGTGGCATGTG
CATCTACGGGCACAGCTGCACATGCTCTCAGACGAAAAAGGACTGCTCGTTCAGCCCTGCGTTGCACAACGTGGATACGT
CCGCGTGGAAGTTTGTGCGGGCAGACAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62