GenePrediction:GLEAN_3773 Details

Name: GLEAN_3773
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:818677..820366 (+ strand)
Length: 1690
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:818677..819506 (+ strand)
Length: 830
Type: CDS
Source: GLEAN
Position: GCSC_113:819566..820229 (+ strand)
Length: 664
Type: CDS
Source: GLEAN
Position: GCSC_113:820289..820366 (+ strand)
Length: 78
>GLEAN_3773 class=GenePrediction position=GCSC_113:818677..820366 (+ strand)
ATGGCCAGCAGCACCAGCACAAACAAGAGACGGTCGCGTCTTCAGCCAGCCGACGATGATGCTGTGCAGGACCTAGTCTG
CGTGGGCTTTGGGCCGGCCAGCCTTGCCGTAGCCATTGCGCTGCACGACTCGCTCGAGGCCGGCAGCCCAACCTTGGCCG
AGGACCGGCCGCTGCCCAAGGTGCTCTTCCTGGAGAAACAGGAGCAGTTTGCCTGGCATGCCGGCATGCTGCTTCCGGGA
GCCAAGATGCAGATTTCGTTTGTCAAGGACCTGGCCACGCTGCGCGACCCGCGGTCTGCCTTCACCTTTATCAACTACCT
GCACTGCAATGGCCGCCTGGTCGAGTTCACCAACCTCAACACCTTTTTGCCTGCCCGGGCCGAGTACGAGGACTACCTCC
GCTGGTGCGCGAGCTTCTTTGAAGACACTGTGCGCTACAGCACCGAGGTAGACTCTGTCGAGGCCGACCAGGACGGCCAG
GACGATCAGAACAGCAAGTCGCCCGTCACCATTTTCCGCGTGACCGCCTACGACCGCAATGGCAATCGCCAGGTCTTCCG
CGCCCGCAATGTACTTCTGGCCACAGGCGGACGGCCGTCACTGCCGGCCTGCCTCCCTGCCAACAACCCGCGGATCATCC
ATTCGTCGCAGTACGCCCACCTGGTGCCGGCCATCCTCACCAATGCCAGCGCACCATACCGTGTGGCCGTCGTGGGTGCT
GGCCAGAGCGCGGCCGAGATCTTCAACAACATCCAGGGCCTATACCCCAACTCCAAGACCTATCTGGTCATGCGGCAGCA
GTTTTTGAAGCCGAGTGACGACTCTCCATTGTGAGTACAGGCCCAGGAAGAGAAAAGAAAAAAAAAACCCCCATTCACTG
ATTTGTCAGTGTAAATTCCATCTTCAACCCCAGCTACATCGACGAGCTGTACCCACGGCCAGCTAGGTATCGTCAGCACC
TGTTGGCCGACGCGCGGGCGACCAACTACGGGGTCGTGCGGCTGGAGCTGATCGAGACGCTGTACGAGCGCATGTATCAC
CAGCGCCGCACTCTCGGCACCGACGAGACCAAGTGGCCACATCGGCTACTGAGCAGCCGTCGGATCGCGGGCGTGGAGCC
GGACGAGAAGGGCAGCCTGCGGCTGCTTGTCGAACCGGATGATGAGGGCGAAGAGGCTACAAACGGCACAAGTGGCAATG
CCAATGGCCATTCCACTAAAAAAACTAACGGTCATACCAACGGTCACAATGGCCACACGAACGGCACCAACGGCCACCCC
AAGACCGAAGAGCTCGACGTCGATCTGATCATTGCCGCCACCGGTTACCAGCGAAACGCCCATCTGGCTATGCTGCGCGA
CCTCTGGCCACTGCTGCCGGAAAAGACGGCCGCCCAGCAGACGGCTGAGAAGTGGGAGGTCAAGGAGGACGAGTCTGACA
GCCCCACCAGAATCCTTCGGGTCTCGCGTGACTACAAGGTCCAGTTCAGTGCTGGAAGTATTGCAGACGGATCTGGCGTC
TGGCTGCAAGGCTGCAACGAGGGCACACATGGCGTGAGTCATCCAGCTTCGTCTATTTGTCTGCTTTCTCAACTCCGCTA
ACAACCCTACAGCTTAGCGACACGCTGCTGTCGGTGCTGGCTACGCGCTCAGGAGAGATTGTGGAGTCGATTTTTGGCCG
GGAGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62