GenePrediction:GLEAN_3774 Details

Name: GLEAN_3774
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:822257..837956 (+ strand)
Length: 15700
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:822257..823395 (+ strand)
Length: 1139
Type: CDS
Source: GLEAN
Position: GCSC_113:823453..826607 (+ strand)
Length: 3155
Type: CDS
Source: GLEAN
Position: GCSC_113:826663..828821 (+ strand)
Length: 2159
Type: CDS
Source: GLEAN
Position: GCSC_113:829944..837752 (+ strand)
Length: 7809
Type: CDS
Source: GLEAN
Position: GCSC_113:837816..837956 (+ strand)
Length: 141
>GLEAN_3774 class=GenePrediction position=GCSC_113:822257..837956 (+ strand)
ATGCAAGCAACCGCGGACGTCGAGATGCAGCTCTCCGTCCTCAATCCCCAGCCACAGAGGCTGCCAGGGCCCGGCTTGCT
GCATCACCTATTATTTGGTGCGGAAACGGGGCCTGTGAACTCAGAATATGTCGTCTCGCGCCGATCTGAGACAGCTGCCG
TTCCGGCACTTGATTACCAGTCCCCCGACGGCCGGCGTACTGTCTTGTCGTACAGCCAACTGCATCAGAAAGCCCAGCTA
CTGGCATCAGAGATCAGCCAGAGACAGCTCAAAGCTTCTGAAGCCTTGGCTTCAGTCAGATCCGGTGATGCGGGAAGCTC
GTTTTCGGCAAAGTCCCAATATGACAGCAGCGGAAGTGTGCCGCTTAAGGACCTGGTCGTTCCAGTGCTCGTTCCCCAAG
CTCCAGAGCTCTACCTCTCTCTTCTGGCCATCCTTAAGGCTGGGGGGGCTTTCTGCCCGATCCAACTGGATGCGCCAGCT
GATCGCATTCGCTTCATTCTGTGCGACGTGTCTGCTACTGTTGTCTTAACAACACAGGAGATGGCATCCAAGCTTCCGTC
AGACCTGGCCATCGAGGTGGTGTTGGTTGACCAAATTCATCTTCTTGACGACCTAGACCTGCCTCATGATACGACTCAGT
TGGCCCTGACAGATGCACCACCGACGCGAATTCCCACAGAAGTCGACCTCGCCTACGTCATGTACACGTCCGGGTCGACA
GGCACTCCCAAGGGTGTCGGAGTGCCACATATCGCTGCAACCCAGAGTCTCCTCTCCCATGACCGTCACATCCCGCCCTT
TGAGCGCTTCCTGCAGTTTGCCGCCCCGACCTTTGACGTATCCGTCTTTGAAATTTTCTTTCCCCTGTTTCGCGGCGCCA
CCCTCGTCAGCTGCAGCCGTGCAGAAATGCTGAGCGACCTACCGGCCGTCATCCGCAGCATGAATGTTGATGCCTGCGAA
CTCACGCCCACCGTGGCCGGAAGTCTCCTGCGCAGCCGCAAAAACGCCCCGTGCTTGCGCCTGATGCTGACCATTGGCGA
AATGTTGACAGAGCCGGTTGTCCGCGAGTTCGGCGCCAGTGCTGGTCACCCCAGCATACTGTGGGCCATGTATGGTCCTA
CCGAAGCCGCCATCCATTGGTTAGCCACCCCGAATCCTAAATACACTCTGATGACCTACTTCTGACACCAATACAGTACA
CTTCAGCCTGCTCTGGATGGTGCAGCCTCGGTGAAGAATATTGGATTCCCTCTGGACACCGTTTCGGCGTACGTCTTAGA
AATGCCTTCAGGCGATCAGCCGGCTGGGCCAAAAGACCCCAAAATTGTGCCCCTGGGCGACGTCGGCGAGCTGGCTGTCG
GTGGGTACCAGCTGGCCCGTGGTTATATAAACCGGCCTGAGCAAACCGCTGCGGCTTTCATCGATACTGAGAAGTTTGGC
CGCCTCTATCGAACTAGCGACAAAGCCCGCATTACCGACGAGGGCATCTTGGAGTGCTCTGGACGCCTGTCAGGCGGACA
GGTGAAGCTACGCGGCCAGCGAATCGAGCTTGGTGAGATTGAACAAGCTGCTCTTCGAGCGAATGGCTGTCTTGGAAGCG
CAGCCGCCGTGATCAACGGAAATCTTGTCGCCTTCTGCGACGCTGGGCCGAATGAGGAAGCGGATATGAAACAGAGGGTG
TTAGAGTCATGCAAGTCTTGGCTGCCCCGGTTCATGATACCCGGCGATATTGTCATCATGTCCGAGTTCCCTCGTCTAGC
TTCCGGAAAGGTCGACCGCAGACGTCTTGTCGACCAATATGCAGATTCATTGCGATCGGCAGCAGCTTCACAGTCACTCA
GCCCGACAGTCTTCAAGGACGATCTCGATCGTCAGCTCCATGAAATTGCACGTGATATCCTCGGCTGCGAAATAGAAAGC
AACTTCCCGCTGGCTGCAGCTGGTGTGGATTCGCTGCGGTCGATCCGATTTGCAGCCTCGATCCGATCTGCAGGATTTCA
TAACGTTAGCGCTGTTGATGTGCTGGAAGCCAAAACATTGTCTACTCTCCGTGCTCGGATCCAGCGTCTGAAAGACGATG
CTGCAGAGACTAGCGACGATGTCGACATACATACTGCACAGGAACTAGATGCGGACACCATTCTCAGCGCAGCTCCCGTA
CTCGAAGGGATAAGCAGAGACTCTATTGAATTCATCTCCGAATGCACCCCGGTCCAGGCTGCCATGCTCGGCGAAACGCT
CGCAGACCCACAAGCCTATTGCAACTGGATCGAATTGGGCTTCGCAGGCCGGCACGATGCCGATGAGATTGCGTCTTGTT
TCCATCGTCTGATTGAGGCAAATGAGGCCTTGAGAACTGGCTTTATCCACTTTGATGGCCGGTTTTCCCAGGTGGTTTGG
AAGCAGGCTTCTCCAACACAAATTCAAAAAGTCGACTTTTCGACACGCGACTATGTCTGGGGTACCGAGCAATCTTTTCT
CATGGGTTTCCGTGTCGAAGTATTCGAGACAGAGTCTTGTGACACGGATATGACTGTTCGCGCCGTTTTGCATATCCATC
ATGCAGTCTATGATGGATGGTCTGCGGACTTGATTCGCGCAGACTTGGAGACAATGCTTGGAGGTGGTGATATCGCAGCA
AGACCTCCGTATAGTCGCGTGGTTCAGCACTACCTCTCAATATCCACAGACGCGACTGATGCAGCGAAGCAGTTCTGGGC
CCAGTTGCTGAACGGACATCAGCCCAGTCCATTCCCAGAATTGAGGACACGGACCGACGAGCCTACTGCTATTCTTTCAC
TGGAAAGTCTTCTACCGAGCGTAGACTCCGACGCAGTCGAGAGCATCTCCAGAAAGCTCGAGTGCGGCACACAAGCTATT
TTCCAGGCAGCATTGACATGGCTCTGGGGTTCTCTAATTGGCTCAAGTGACGTTGTCATCGGCACGGTAGCTTCTGGTCG
GACGCTTCCGGTGGATGGGATCGAGGACACTATCGGCACCTGCCTACAGACGGTACCTCTTCGCGCCGATCTCTCACAGA
TGCGAACGATCCACGATCTTCTGAGCACCATACAGTCTACAAACAGGGCACTTCTTCCCCATGCGTTTCTACCTCTTGCT
GAGATAAAGAAAACAGCAGAGCTGCTCCTTGGTCAGCCGCTGTACGATGTATTGTTTGTGTACCAAGAGTCCCTTTACAG
CCAGAGGACCTCGCGGGATCTCGTTTCAGAAGTGGCTCACAAGGACTATTTGGAAACAAAACTGCTTTGGGAGATCGAAC
CCAGAGAGGGCAAGTTTCACATTCGAGCGACCTTCCACGGCGACGTGTTCCCCAAAGAGCAGATTGATGTCATGATGGCG
CAATACCTCTGCATTGTTCGCCACCTGGCCAACAATGTGGATAAAGAATTGACATCCATTCGCTCCTGCTTTCCACAAGA
TCTTCTCTCATGCTACAACATTGACTACAAGACATTCAATGGCTGCGCAGATCTCGCGCACGTTTTTCAGAAAACGGCTC
GGCAATATCCTAACAGGCCAGCTGTCTGTTTTGCGAGTTCCATAGGAGAAGATGGCATTGAGTTCCAAACGATCAGTTAT
CGTGAACTAGATGGTCTTTCGAATCGTATCGCCAGATACCTGCGGTCAAATGGGGCGGCTCCAGGAAATATTGTGTCTAT
TATACTGGAAAAATCAATACTTCTTTATGCTGGCATGATTGGAATCCTCAAAGCCGGTTGCACCTATGTCCCTCTCCTTC
CAAGCATTCCTTCTGCCCGAGCACGCACTATCATGGAGCAGGCGGGCATTCAGTTCTGCTTGACCAACAGGTTAGCAGCG
GCCACCCTTGTTGGTCTACCAGTAACGCCACTTGATCTTCAGTCAACCGATCTCGACAAATTTTCAGACTCTGCTGTTGA
GGGTGTACCCGTTGAACCTTCTAGTCTGGCATACATCATGTACACGTCCGGAAGCACAGGCGTTCCCAAGGGTGTCTGTG
TCACACACTTCAACATCTCCAGCCATTTGGATGTCTTGACACGCATCTATCCACTCAGGCCCGATGGGAGGTTGTTGCAA
TCTTGTTCGCAGGCCTTTGACGTTTCCGCTTTTGAAATTTTTTTCACTTGGAAGACGGGCATGTGTCTCTGTTCAGCGGT
CAATGACGTTCTCTTCGATGATCTGGAACGTGCCATTCGTCTACTCAACGTGACCCATCTGAGCATGACTCCGACCGTAG
CATCATTGGTAAATCCAAAGAATACTCCGTCTGTTGAGTTCCTGGTGGTAGCCGGTGAGCCACTCCTAGAGAGCGTTTTC
AACATGTGGTGGCCAACGGGAATTCATGTTGGTAAGTTGGTTATCTGTTTTATGGTCCTGTCTCGTGCTATGGCTGACAC
ATGTAGGATACGGCCCATCCGAGACCACAAACATTCTCACAGTAAAACATATGACATCCCAGAATGACGTCACATCGCAG
CTGGGATTTTCGTTTGAAAACACGTCGACTTTTGTTCTTCACTTCGACAGTCTTGAGCCAGTGTCTAAAGGGGCGTTGGG
CGAGTTTTGCTTCGGAGGTGATCAAGTTGCGGCAGGATACTTGCAGCTGCCAACGATGACCGCCGAGAAGTTTATCGATC
ATCCGTTTTATGGAAGAATCTACCGCTCAGGTGACGTCGGACGAATGCGTCCAGACGGCTCTCTGTTGATCATTGGGCGG
ATAGACGACCAAATCAAACTTCGCGGCCAGCGGATCGAACTCAATGAGATCAATTCCATTCTCCAAGAATCCGGACTTGT
ATCGGAGCCCATAACGCTTCTTCTCCGCCACGGCGACTCGAACCCTGAGTTGCTGGCATCTTTCTTCACACCTTCCAAAC
GAGATAGTTTGGGATCCACATTGTCCACATCCCATGTTACCGACTTGAGTAATGAATCCTCTTCCTTCATGATCAGGCAG
CTGTTCAGCCTGTTGCAGTCACGCCTGCCAGCCTACATGGTCCCAACTCATCTGATACCAATATCGTCCATCCCGCTTAC
CCCGGCCGGAAAGACAGACAAGCGAGCCTTGAAAGAGCTATTTCAAGCTCTTCCGCTGGAGCTTCTGTCTTCGACGAGCA
ATTCTGGCGGAAACATTGATGGTGGTGACAAAAATGGCGGCCAGTGGTCGGAGTTGGAAAAACAGATCGCCCGGATCATT
TCTGAGGCGCTCAAGGTTGGCGTGCAGTCCATTGGCCGATGGACACCTCTCCCGAGTCTCGGTCTCGACTCAATCTCAGC
TATTCGTCTGTCCAAACTTGTTCAACAGTCACTCCAACGCCGGCTCCCGATTTCAGTTATCCTCAAAAATGCAACTGTCG
CGCGGCTATCACAGGCTCTCAGGGACGAGTCCCCCAAAATCGATGCGCCAAGCCTCTATTCGCTCGACCTCTTCTCCGCA
AATTTCCTTTCCGAGTTGCGGCAGACACTGGATTCTCGCGGCCTAGTATGTGGCAAAGTACTGCCTTGCACACCCCTGCA
AGAAGGCATGCTCGTTTCTCCTGCACGGAACCAATCTTACATCAACCGCATGCTGTTCAAGCTGAGTGTTCGCCCAGAAA
AGTTGCAATCCGCTTGGATGAGAATAAGCGAGCGCGAGGAGATCTTGCGCACATGCTTTGTTACAACGGACAGTCCCAGT
CATCCCATCTCCCAAGTCATTCTTGAAGGCTGGAAATCATCATGGATTGAATATGATACGCAAGATTCAGACAGCCAAGG
GACTGCAACTTCCATTGAAAACGTCATCGATCGGCACGTGCAATCGCTGGCAGATCCAGTTGACTCATACCAGCCGCCTG
TCTCCTTTGCGGTCATCAGCCAGTCAGATGGATGCTTCCTATCATTTGTTTGTCATCATGCAATCTACGATGGAGAGGCT
ATGGAAAAGCTATTGTTTGAGGTTGAGCAAACGGTCAAAGGAAAGCCCCTCCCACCAACGGTTCCTACGTTTGATTCGTT
CTTAAGTCAGGCCCTTTCTCTGCCTTCATCGACAGAGGATTTCTGGAAGAATCACCTGAATGACTTCAGACCAATATTGC
TTCGGAACGAAAGCTCCATCTCCATAAGAGAAAGCAAAGTTTCAGCCAGCATTCTCGAAATGCCTTTGTCCGGTGTGCAG
GAGCGGGCCCACAATCTCGGGTTCTCACTTTTGACCACGCTCCAGAGTGTTTGGACATGTGTTCTCAGTCTACTGGGAGA
AGAAGACGACGTCTGCTTTGGAAACGTGTACAACGGTCGATCTCTGCCCCTAGGCGGAAGCGATGAGCTTGTTGCGCCTT
GTTTCAATACCTTGCCCGTCCGTGTGCAGTTGTCGACGTTACGCACCGTCAAGGATCTGATGTCATATTTCCAAGCGTTG
AATCCAGATATGATGAAACATCAGTTCACACCGTTGAGACATATTCAGAGAAAATATGCTGGTGGTAGTGGCCGCCTCTT
CGACAGCCTCTTGCTGCTCCAGCAACCGTCACGACCACTTGACAGCATAGTTTGGACGCTTGAACGAGACGATGGGGAGA
TGGATGTTAGTTTATTCTCTTGACTGCTCTTCTTCAAGACAGTGGCTAACCCATTTGATAGTTTCCTCTTGTTTGTGAGC
TGACCCCTAACCAAAGCCAAGACAGCCTGGGCATTCAGATCCACCACGACAGGTAAGAACCAAGCACATCCCGCGGTCCT
GTGTCTCTATGGCATATTCGCCAATACGAAGCTAGCTCGTTCTAAGGATAGTTTTGTGTAGTGCATTTGTCTCTGATACT
GCATCATCGCTCGTATCGGAACTATTCGGGAATCTATTTGAAAGCTTTTTGCGTTTTCCCTCCTCGCAGATACCTTGCCG
TGACGACTTGGCACCTCAACTGCGCCAGAAAATTTGTGAAGCGGGTTTGCAGTTTCACCGCATGGCACCAATCGACAATG
AAGAGAGACAGGCTACAGCGGGTTCACAGTCTGTAGAGGACTGGAATACAACAGAATCCACCATCCGCTCAGTTCTTTCA
CACTTGTCTGGTGTTCCAGAAAACCACATCCGAAGGAGTACAACTCTTTATCGTCTGGGACTCGACAGTGTCAAGGCGGT
TCAAGTTGCTGCGAGGCTGCGAAAGCAAGGCTTACCAGTCTCTGCTGTAGATGTTATGGAGTACCCTAGCAGTATGGAGC
TCGCCCAATGTCTTGCGAGAGCCTCTGCTGCAGGTTCGGAAGCGTCGGCACTGAATTCGTCATCCGACATTCCTTTATTA
TCTTCACCAGCGTCATCCTCGGCAGAATATGATTTCTCGAACTTCAAAGTACATCTTCAATCTTTACTTGCCAAGCATGG
GCTCGCAAACGAGGATGTCGAAGCAGTTTTCCCATGCACACCACTCCAGTCAAGTCTGCTTGTCGAGTTTTACCGCTCAA
GTGGGCGCCACTACTTCAACTTTGTTGCCCTTCAGGCCAATGCTGATGCAGTTGTGGCTTTGACTGCTGATAGCTGGGCC
AGAGCGTGGGAGCAAGTCGCAATGATCACTCCAATGCTCCGGACTGGGTTTGTCAGCATGGAAGATGACAAGATGATTGA
CATCCCATCTCCATTTGCAATGGTCCAATACAGTACTCCTGCTGCTATATCTTACCACACCAAGATTGCTGTTGTTCCAA
AAAACAGGATCGGCTGCTTTTCAACCTGTCGAAGTGGAGGCTCGATGCAGCGCAAGCTGCAATCAACAACATGCAGGTGC
CACCGTGGCAGATCGTCATCGTGGAAGACCTCAATGGCACGGGAGTGACCTGTCATTTGGCCATTCATCATGGCCTGTAC
GACGCGGCCAGTCTCAGTAGTATTCTTGACAATGTTTCGCGATATGCCAGTGGCTTACCACTCAAACGGGCTCCACAGAC
TGAGACTGCAGTGTCCGAGATTCTCCATCAAATCACATCATCTACGTCTTCAGATATATCCGAAATGTGGAAGAAACTGG
CCACACGTGCAGTCATCAATACATTCCCTGTTCTCACACCACTCAAGGCCAAGTCGCCTTTGGTGAAAGTTGCAGTCAGC
CAAAGCTCCAAGTCGTTTACTGAGATTTTTGGTGCCGCCATGAACTCTGGTTTCACCGTTCATGCAGTTCTCCAGGCAGC
TTGGACTCGAATCCTTTCGTCATACATCGGAGATTCCGGTGTTGTATTTGGAACTGTGTTGTCTGGACGAAACTCAGAAG
CGACATCTGACGCCGTCTTTCCGTGTCTGACAACGCTTCCTGTCGTTGCAGAGAATCATGCATGCAACCGCCAACTTGTG
GAGCAGTTGATGAGTTCCAATATCCTGCTCCAAAAGACACAGCATGTCCCATTAAGCCAAATTCAAAAGTGGCTGGGACG
AGCTGACTCGCGCCTATTTGATACTCTTCTGGTCTACCAAAATATTGACCGCAATGGGGAGGCTGGACAAGTCCATCTGC
CGTGGAAAATCATCGACGAAGAGGCGCATGTTGACTATCCCATCTCTCTCGAAGCCACTCCTCAGACAGATGGGCCGATG
CAGTACCAACTCACGTTCGATGCCAGCGTCATCCCCGTCGAGCAGGTGGAACTCCTTCTCCGCCAGTTCGATGCCACCGT
ATGTCACCTCGCTTTTCACCCTGACAACAACGAGGATGATTTGATAGCAACGGAGCCAACGATTTTCAGTGCCTTGCCTG
CACGAGACACAGAGCTGGAGTCCGAAATCAAGCTGATGCATCAATTTGTGGAACACCAGGCAAGGAAAATACCGCACAAA
ACGGCTTTACAGTTTGTTACGGCTTTTGACGGCGCCGGAAACCCAGTCTCCAAAGAGTGGACCTACGCAGAGCTGAATCA
TCGCGGTAACGCGGTAGCCTCAATCGTGTCTCAGCATTCTGTCCCGGGAAGCATTGTTTCCATTTGCTTTGACAAATGCC
CCGAGGCTTTCTTCGCAATTCTGGGAATCCTCAAAGCTGGATGTTCGTTTGTAGCCTTGGATCCCGAGGCACCATCAACC
CGAAAGGAATTCATCTTGCAAGACTCCAAAGCTGTCCTCCTCCTTACAGACACTCTGAGGGCATGCCAGCCGTCGTCTAC
AACAGGCCTTTTCGATTCAGCTGTGGGGGTGGCAATCATTGGATTGGACGAGTCCTCTCTGGCATCCCAGCATGCCGGAG
ATCTGGACATTCAATTTTCCACAAGTCGTGAGATTCTTCCAAACGACAACTGCTACTGCCTGTACACATCTGGCACAACC
GGGACACCAAAGGGTTGTGCGATCACACATGAAAATGCTGTGCAGGCTATGCTGGCTTTCCAGGAGCTGTTCCGGAGCCA
CTACGACGAAACTTCGCGTTGGCTTCAATTTGCCTCCTTTCATTTTGATGTCTCTGTTTTGGAGCAGTACTGGACTTGGT
CTGTTGGCGTTGTTCTCGTTGGTGCTCCTCGGGACCTCATTCTTGAAGATCTTGCAGGCACGATATCACGGCTCTGCATA
ACTCACATCGACTTGACACCGAGCTTGGGACGCCTGCTTGATCCAAGCGATGTCCCGACTTTGTGTCGAGGCGTATTCAT
AACGGGAGGTGAGCCGTTGAAGCAGGAGATGCTGGATTCTTGGGGCCCAACTGGTGCGGTGCACAACTTCTATGGACCAA
CAGAAGCAACGATCGGTGTGACATCGTACCCTCAAGTGCCACAAAATGGACGTGCATCGAATATTGGCAGGCAATTTCCC
AACGTCGGATCTTTTGTGTTCCGCCCTGGAACACAGACCCCAGTCTTGCGCGGTGCTGTCGGTGAGCTTTGTGTCTCCGG
AAAGCTCGTAGGCAAGGGCTATCTCAACCGTGAAGACTTGACGAGTGAACGCTTTCCAACTTTGAGCGAAGAAGCCTACC
CAGGGTACGGGGAGCGCGTCTACCGTACCGGAGATCTTGTGCGGCTGTTGTACGACGGCTGCTACGACTTCCTTGGGCGG
GCTGATGACCAAGTAAAGCTGCGAGGTCAACGACTTGAAATCGGCGAAATTAACCATGCGATACGTCTTGGAGTTGGGAA
TAGCATTGGCGACGTTGCAACACTTGTCATACGGGACGACGTGAACAAAAAGGACTTTTTGGTCTCTTTCGTCGTCATCT
CAGACACATCTTTGGCTTCGTCTGCAGTTTCGAGAAAAGGTCTTTCTTTGGTGCCGATTCCAGGCGACACGGCAGCTGCT
CTGTCCAGGCAAGTACAGGCGGCTTGCCGCGAACGACTTCCGGGATACATGGTGCCGACTTATGTGGTCCAGCTTCCGTT
CATTCCGCTATCAGCAAACAACAAGGCTGAGGCAAAAGAGCTGAGACGGCTGTTCAATTCTCTGACACCAGAAGACCGCA
TGAAAACGACGGGAGCCGGCCATGCTGGCGACCAGATCGATACCCTGAGTGGCTCTCCTGGGCAAGAGTTGTTGTATGTA
TTACGCCAGCTGTCCCTCTTGGACAAGGACGAGGGGCTGGCACCGAATACTAGCATATTCGAGCTGGGAATCGATTCAAT
CTCGGTCCTTCGGTTTGCACGGGCTCTCAAGAAAATCGGCCTTCCTGCTGCACCGGCACTTCTCCTATCTCATCCTATTA
TCGGCGACCTCGTTATTGCGTTGAAGACTCAAAAAACAGCTGCCGATCTTGGGCCACTTTTGGAAGCCCGTCTCCTTGTG
GAAGCCTGCCAACACAGAAACCGTAGCCATGTATGTAATGCGCTTGGCATCAGCCCCGATGATATCGAGTACATTGCCCC
ATGCTCGGCTCTTCAACAAGGCATGGTGTCTCGATCGAGGTCAGGACAAGAAACCACGCAAGCATATTTCAACACGTTCA
CATTCAAGCTGGCGGAGGATGTGTCGATCGAACGCCTGATGGAAGCCTGGAAAGTGGTGGTGCGAAGAAACTCGATTCTT
CGCACTCGGTTTGTTGTCACCAATGAGGGCGTTGTCCAGGCTGCCCTGAAGTTTGCCGACGTTCCATGGACACAAGTTTC
TCTAGATGGCGGAAAGGACATCGCAGAAGCTTTGGAAGAATATACTGCTGTCTGGGTCAGCTCCAACGATGGTGATGTGA
TTCGCAGCCCTCTTGAATTCTTGGTGGGCGAACGGCAGGGAGATCGGTGTTTCGTCATGCACATTTTCCATGGCCTCTAT
GATGCCATCAGTTTGGATCGCATTCTCGACCAAGTTTTTGCCGACTACGAAGGCATGATGGGAGACGATGGCCAAGATGG
CGGTACGTCGTTTTTGGATGCCTTGATACACGGACCTCTACGCAGCTATGGGAACAGCCGCCCTTTCTGGGAGACACACC
TCAGAGAAAGTTTCTTCAAGCCACTTTCAAGTTCGGCTTCATCGGCAGAAAGCCTCCTGGACATCACTGCGAAGCGGTCC
ATTCCCTTTGACTCTATTAACAGTCTCTGCTCCTCTTTGGGGGTTACTCACGCAGCCTTAATTCAGGCCTTATGGGTAGC
TGTACTCCAAGAGACATATGGCGATGGCACTACCCTAGGCCTGGTTCTTTCTGGACGGACCATTTTCGACTTGGACGGTG
TCGAAGGTGTTATTGGTCCGTTGTTCAACACGCTTCCCTTCTACATGCCGAGAAGGAAGAACGAGACCTGGGCCTCACTT
GCAAAGGAATGTCATGCCTTCAACACGGCCATCCTACCATTCCAACAAGTCCCACTTCGAGATGTTCAAAAATGGTGTTC
TTCTGGGCAGCCGCTATTCGACATCTTGCTTTCATTCCAATTTGGTGGCGCGTCGTCATCTGCTCAGAAGATCTGGACAG
AGGTGGACTCAAGCACTCAAGCAGACTACCCCCTCGCCCTCGAAGTCATCCTAGATGGGGCCACTGATGGCACTTCGAAT
GTCGAATTTTTGCTTGTTGCCAGGGCTGGGGCTTTCGAAGAAGCAACGGTTCATCAAATTGTTGACAGACTTGTCTTGGC
AGTGGATACAATGTCAAGGAACACTGAAGACTTGATTTTCGCGGCTGAAAGCGAAGATTGCGCCATTGCGGAGGAGGCAA
GTGACATCGTCAATTTTGCCGACAGTGGAAACTCACTTGAATGCGTTGCTAAGAAAACGCCTGCCCATCTTTCGCTGTTC
GAGTGGGAAGGCGACGCGACGAAGATCAGGCAAGAGCTCTCCCTCTTGAGTGGAACCACAATTGACTCGATCCACGAAGA
AACGACTCTCCTTGAGCTTGGCCTAGACAGTGTGGACACAATCAAACTCTCAGCACGTCTTAGAGCACTGGGAATCCATC
TTTCGAACAGTCAACTTATTCGTGGCCAATGCATCTCGGAGCTCGTCAAAGTGATTGCCACGACAGCTGGCAAGACGGGG
GAAAACGATACTGATGGCAAGGCCGACAAGTCTCTTATACTGTTGAATAGTGTTTCCGCTTCGCTACGGGAATACCTTGC
TCTCAGTGGACGTGACCTTTCTTTCGTGGAAGATGTTTTACCGCCGACCCCATTGCAAGAAGGCCTAATCGCAGATATGA
TTCAGTCTGGATTCACACGTTATTTCAATCACGACATTTTAGAGTTGGAGCCGGGTGTTGATTCAGACCGGCTCAAGAAC
GCCTGGATGAGCGTTGTCAGAGCAAGCCCAATTCTGCGGACAGTCTTTTACGCTGTTGACAGTCTGGAAATTGACGTGTC
CTATTGTCAAGTCGTGAAGCGCGACATTGACATTGAGGATTTGATCACAGATTGCGAAGCCTCCGGTCAAGACGACTTGA
TTGGTCTCGTAGAAGCAGTCAGAGAACGAGCGATGAAATCGGAAGGAGAGTCCGGTCTTCTTCATCTGACTTTCGTCCAC
ATACCAGTAGAACAACGCCGCTATCTCGTCTTGTCTATTTCTCACTCTCTGTATGATGGATGGTCTCTGGATCTGATGCA
CCGCCGTGTCGAATCTGCGTATAGGAACCCGGCGGGTGACACAGGGCATCCTGACACCAGGTCGCCTTATCTTCAGCAGC
TCGGCAACATTCTCAACTCGTCAGGTCCACAATCAGAGAGCTTCTGGAGAAGCTTCCTCTCAAACGCGCAGCCAACGCAT
GTGAAGGCGAGTACGGAGAGCCAGGAGCAAACTGGTGGAGGCAAAGCAGTCACACGTATCGAAACGGCATCCTCAGTTTC
AGCCGCTGGTCTCCTCAGCTTCTGCAGGAAAGAGGCAACGAGCGTACAGGTTGTTGGACAGGCGTGTTGGGCCGCTGTCT
TAGCTACACTGACGGGGTCGTTGGATGTTGTCTTTGGAGTCGTCTTGTCAGGAAGGGAGACCGAAGGGGCCGATGAGCTT
CTGTTCCCGACCATGAACACTGTGCCAGTACGCGTCATATTGCATGGCACAACGGCTGAGCTGCTGCAGTACATGCAGTC
GAATATGGGAAGCATCAGCGAGAACCAACACTTCCCCCTGCGCAAAGCACAGAGAATGGTTGCCAAGTCTGAATTCGTCG
GTGAATACGGTGCTTTCAATACCTTGTTCATTTTCCAGAAGCGAACACCAAGACAGCCCTCTTCCTTCGAAGAAGATAAT
CAGCCACTGATGCATTCGATTGAAGGGTTCTCAGACGTCGAGTACCCGATTTGTGTCGAAATGGAGGTAGTCAGTTTCGC
TGGCAGCGAGTCAATTATTTGGCGGATGGCTTGCGACAGCTCATATGCATCGAGCAGTGATGCCTCCCGCATCGTGCATG
AGCTAGACACTGCTCTCCGATTCCTCGTCCAGTCTTCATCTTCTCCGGCACACCAGGACAGTATTCTACGTTTTGAAGAG
AAAGGCGTGTCGCTTTGCGGGCTGCCGACCTTCACTCCCCTCCTGGCAAAGGAAGTTGGGAGTCAGAGAAAGCAGACGTC
GCCGGTGGAGCTAAGCAACAATTCGTGGTCCCTGGTCGAGGAAGCTATCAGGTCGACTCTGTCGGTGGTGTCAGGTGTAC
CTTCCGAAACTATCAAGAGAAGAGGGCAGACGCTCTATCACCTGGGACTCGATTCCATCAGCGCCATCAAGGTCAGCTCT
CTCTTGAGAAAGACGCACGGTCTATCGCTTGGGGTGCGCGAAATGCTTGCTTCCGAATCAGTTCAAGATATGGCAGCGTT
TGTCACAGCTAAGCAGTCATATGCCACCCCAAATGACGATGAAAAGCAAATCACTGCCTCGATCTCAACCATACTGGATT
CTGTTCAGGCAGATGCAGTAATATGTGCGGCTGGAATATCGAACGATGAGATCCAGCAGGTTCTGCCTGCGACGGCAATG
CAGGTGCATATGGTCAGCGTCTGGCAGACCTCGAATGGTGAGGTTTTCTTCCCCGAGTTCCATTATAGTCTAAGCGGGGT
CTCTGGAGGGCGAGAAGCAGTCTTCGCCGCATGGGAAGCATTGGTGGCCGAAGTCCCGCTTTTGAGAACCGTATTGTTGG
CAACGGCATCCAGCACAGTACCGATACTTCAGGTAATCTTGAAGCCCGCTTCTGGTGTGCGATCCTCCGTCAGTGAAGAA
GTGTGGCCCGCGGTGGCAAGACACAAGCCGCTGGCTTTCTTGACTGCCACATCTGCGACTGAGAGCGACCGTTTTGTGCT
GGCTTTGAGGATTCATCATGCGTTGTACGATGCAGTCAGCCTCCAGACCATTCTGGACCGCTTCCAGCGACTCTGCAGCA
GTGAGGCCACGGACGTGATGCCCCTTGTCAGCGAGAAGACAGATACATTCGGATCATGGACATGGATGATAGCACGCCAG
ATGTCTGAGACCTCCAAGAGACTGCAACAAGAGTTTTGGACCAGGTATTTCTGCTCAGCAGCGAAAGACGCACCCAAACG
TGTGTCTGTGTCGACAGAGGCCCCTCTGGGTCGTGTTTCACTGTACAAAGAGGCGGTCCTTTCAAATATTACCGTCTTGC
GGACAGTGGCCTCGACTCATGGTCTGAGCCTTCAGAGCCTACTGTTTGCAGCATATGCAAAAGCGCTGTGTATGGACAAG
AGAAAGAAAGACGTCATCTTCGGAATTTACCTTGCAAACAGGGAAAACGAGGTCGAAGAAAGCGGGAGGCTGAACAAGCT
TTTGCAATATCCAACATTGTGTTTGGTCCCACTACTCATATCGTCGCCCACACAGCGAAGCATGGTCGACCTGGCACAAC
AAATTCAAAGAGACATCCATGCCATATCGTCACCTCTGGCGCCATCCTCGCCAGCACCAGCAACATCGGGTCTCTGGGAA
ATTCGGGATTGGGCAGGGATTGAGGTAGACTCTTTTGTCAATTTCCTGCTACCAGATCAGGACATGGAGACAAAATCGGC
CGGCGGTCGGTCTGCGAGTCTGGAATTAGTCAAGTCATCGGGCGATATTTCGGCAATGCCCGTGTCTGATACAATCTCCT
TCAAGCCAGACTCATACGATGGCCTAGGGGGAAATACTGTTAAATACGTTTACAAGGTGAGCATACCAGTCCGAGTCGCA
GTTAAGCTACTTTCTTTTCCTTCCACTAACGTTCTACAGGATGCTATTGATTTGGAAATGGCCGTTCGGGGTGATCGGCT
GGACATGGGAGTGTTTGGCTCGCATACCAAGCTTGGGGATGATGGAGCAGGAGAGCTCATGGCCAAAGTCATATTCTACT
TGCTAGAGAGCAGTGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62