GenePrediction:GLEAN_3775 Details

Name: GLEAN_3775
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:840092..841207 (+ strand)
Length: 1116
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:840092..840128 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_113:840216..840891 (+ strand)
Length: 676
Type: CDS
Source: GLEAN
Position: GCSC_113:840943..841207 (+ strand)
Length: 265
>GLEAN_3775 class=GenePrediction position=GCSC_113:840092..841207 (+ strand)
ATGGATAACTACCAAAAACTTGAAAAGATCGGTGAAGGTGCGTGACTGCGGACAAGGTCGCCGGCAAAGGACCAAGTGAC
AAGACAAGGCATGCTGACCGAGTGCGGTCCCATCCGCGAGACAGGCACGTATGGCGTCGTGTACAAGGCACGCGATCTCT
CGGCCGGGGGGCGCATTGTGGCCCTCAAGAAGATCCGGCTAGAGGCCGAGGACGAGGGCGTGCCATCGACGGCTATCCGC
GAGATCAGCCTGCTCAAGGAGATGCGTGACTCGACCATTGTGCGACTGCTCAACATTGTGCACGCCGAGGGCCACAAGCT
CTACCTCGTCTTCGAGTTCCTCGATCTCGACCTCAAAAAGTACATGGAGGCGCTGCCGGTTTCGGACGGTGGCCGCGGCA
AGGCGCTTCCCGAAGGCACCGGCTCGCGTCTGCAACATCTCGGCCTCGGCGACGACATCATCAAGAAGTTTATGAGCCAG
CTGTGCGCCGGTGTTCGCTACTGCCACAGCCACCGCATCCTGCACCGCGACCTCAAGCCCCAAAACCTGCTGATCGACAA
GGACGGCAACCTCAAGCTGGCCGACTTTGGCCTCGCCCGTGCCTTTGGTGTCCCTCTGCGTACCTACACCCACGAGGTCG
TCACGCTGTGGTACCGCGCCCCCGAGATTCTGCTTGGTGGCCACCAGTATTCCACCGGCGTCGACATGTGGTCCGTCGGC
TGCATCTTTGCCGAAATGGCCACCCGCAAGCCGCTTTTTCCGGGCGACTCGGAAATTGACGAGATCTTCAAGATTTTCCG
GTGCGTCCTGTCGTTTTCCTTCCACGTCTTGGTCCCTACTGACAATGCCAGCCTCCTGGGCACGCCGACCGAAGACGTCT
GGCCCGGTGTCACCACATATCCCGATTTCAAGGCGTCCTTCCCGCGCTGGATACAGGACACAGACACGCCGCTGTGCGCC
AGCCTTGAGCCGGCAGGCCAGGAGCTGCTGGAGCTGATGCTCATCTACGACCCAGCCAGCCGCATCTCGGCCAAGCAGGC
CTGCAACCACCCGTACTTTGACGACCTGGCCAGCAAGCCGCAGAGCCGCACCACCTACGGCAGCGGATATCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62