GenePrediction:GLEAN_3778 Details

Name: GLEAN_3778
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:854119..860209 (+ strand)
Length: 6091
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:854119..859578 (+ strand)
Length: 5460
Type: CDS
Source: GLEAN
Position: GCSC_113:859623..860078 (+ strand)
Length: 456
Type: CDS
Source: GLEAN
Position: GCSC_113:860165..860209 (+ strand)
Length: 45
>GLEAN_3778 class=GenePrediction position=GCSC_113:854119..860209 (+ strand)
ATGGACGACAATCTGGGCTTGGCCCATACAGCCGTCACGGGCTCCATATCTGCCGCTGCAGGCTCCGCACAAGAGTTCTT
GGCCAGCAATTTCTCCTTTGACACAGTGTCGCGTGCCACTTCGCCCGGTGTGCCTGGCTCTCTCCGCCCGGACGACGACA
ACAAGAAGCGCTACCGACAGCGCACCTTTAGCTATCTTAGCCAGCTCCCCTACCCGGTCGAGGACGAGGCTGAGCGTGAC
GCCACCCTTGCTGCGATTCTGAAGAACCTATACATCTCCATCAAGGCCGAAGATTTTGCACCCGGCGCCGTGCACTGGTC
TCGCGAGCTGCAAGGATGGCTGAATCTCAAGTTCGACATGACCCGCGACCTGCGAGCCAGCCTGGCCAAGCTCTACTACC
ACCTCGCCATGGCTCCCGGCCTCGAGTCAACCGTGACCGACCGCTTTGGCCGCATGCTGATCACATTGACCAAAAAGAAA
CACTACCTAAAGCCAGGCGATGATCTGGTCTTGGATTGGCACCCGCTCTGGAAACAGCTGAAGAGCATAGTGCTGCCCAG
CGAGATCGCTGTACACCAATCTGTTCAGGCTCGTGTGTACAAGCAGATATTACGGCTCTGCTTGCACGTCCAGTCCTATC
TAGATCCGGGTGAACGTCGCGAGATGCTCGACGAGATACTCCCCTACTTCAGCACCCCCGACATATCGAATAGCTTCGTC
GTGATCGGCTTGCTGACCATCATGGTCCCCACAACCCCCGCTCCCCCAACGAAGCCACAGTCCCAGCCGTCCGCGTTTCT
GCCAACATACTTCCACCTGTGGTCGTTGGTGAACCGGTCCAAGGCCGTTGACGTCTCGTTTCTGGACATCCTATCACGTC
TTGCAAGGGACCATCTCACGTGCGCGCATGTTCCTTTTACCGAGCACGGCATCTTCACCAAAGACCAGTCCGATCTCTTA
TTTACCTCCCTTCTGCGGCTGACCGAAATCCCTGTCGGCCAGGCGAACTCGCCCTATGTGTCCAGCCTGTCCTATGCCTC
TGGGCTCGCAGTTTTCCTCGACAAGGACCGGAAAAAATATCCCATCCCTTACATGGCTGCCCGTTGGATCGCCCATTCTC
TGTCACCGGCTTGCCTGCTTCCGCAAGACAACAACTCGTCGCCTGCCAGCAGCGTTCTCACGGGCCTGGAAGGCTTCTTG
GAGTCGATCGACACCTTTTTCCATCCCTCGAACCAGGGTGTCTGGACTAGCTTCCTGGCCCAGTTTACGCATCACCTCGC
AGACATCTTTGTTAATCGCTGGAACCGAGAACAGAGCGGAGAGCTTAACACACCCGCGTCTCGTCGCATCACACCCGAGC
TGAAGCGCCGGTTTGTGCTGGCCCTCCGCGACGTCACGTTTATGGGCCTCTTTGGCAAGAGCCAGAAGGTTACCGGCTAC
TATTATGTCACCCTGCAATGCCTCGCCTTCCTCGAGCCGAGCCTCATCCTTCCCGGCGCGCTGCAACGCTTCTACCCAAG
TCTTCAGGGTCTGGTTGAGGTGCACCGAACGACAGCCAGCTTGTGTGGTCTGCAGATGATCGCTCATATCCTGTCACGCG
AGAAAGGCTTCCGCTGTCATGTGACTGCCCTGTTGGCGCTGGCCTTACCTGGCATTGACGCCAACGATCTGGGGAAAACC
CAGCACACGTTGAGCTTCATACAGAGCGTGGCGCATAGCATCCCATTCGCGTCGCTGACGAGTGACGAGAGCGAGGTCCA
TGATACCGGCCTTGCCGTCCAATGGGTTCAGGGCGAGATGGAGCGCTTTGAGCGTGAGGGCCAAGACGTTGAGATAGACT
ACAGCGCCGAGCTCTCAGACGAGGTGGAAGCTAGCATTCTCCGCTCCTCCACCGCCGGCTTTGGTGAGTTCATCCTCGCA
CTGCTAGGCAAGGTCTTCACCTTGGTGGAGAACCTGCCGGACTCGGCTCATGTTCGGTCTGGGTCGCCGGAAGACAACGT
GATAAATTCGCTGCCTGCTGCCTTTACACCATTATTCGCCTCGCTCTCGCCTGAGCTCTTTGATGTTGCTCTGGAAAAGC
TTGCGACCTTTGTTGGGTCGCACGTCGTCAACCAGGCCAGAGACGCGATGGCCTGGATTATCAATGCTCTCTGCAAGGTC
AATCCTGAGAAGTCTCTGAAGGTCTTCGTACCAATGCTGATTGTCAATATTCGCAACGAGATCGACTACAATGGGGCTGC
GTCTGACCGGAATAGTGGTGCCGATGTTCTTCCACGGGACCGTGCCCTTGTCTGGTATGTTAGCATCCTCAGCATGTGCG
TCGTCCATGTCGGAGGCGAGGTTCTGAAATACAAGAACGAGCTCCTGTCTATTGCAAAATATATGCAGGAAAGGTGCCGG
GGCCTTCCGACCCTCCACGTTTCCAATTTTGTACATCATCTGCTTCTGAATCTGACGCAGACGTACACTATTGACAATGC
CATGTTCGAGCCCAATGTTATCAAGGATGGCGTTCGAATTGAGCACTGGGGCCATACCACAGCCCCCTCCGAGCTCACTA
TCAAATGGTACCGGCCTTCGCAGCCGGAAATTCAGTTTGCAACCGAGCTCTTTGAGTCGCAGGTCAGCGGCGCCAAGGAA
AAAATGGAGGCTCTGATGAGCGAAGAGCCACCGGTGAGCCGCAAGGGCAAAAACAAAGAGTGGAGCGACGAGCTGTCTCG
TGCTTTGAGTCAAATCCGCCTGGTTATCTCTGGAGTGTCGGCACTGTTCGACCCTGCCCGGGCCTCGACAACGACAGGCT
CTGAGGACCGGAGCGAAAGAAACGTCCATGGCGTTGATGACATGCAAATTGATGGCGATTCGACAACATCTAGGATCGTA
AAGGGTGTAGACGACGACACGGCCATGGATGAGGACACCGATCCGCTTGCCGAAGTTGCTGATGATGATGAGCTGCGCCG
CCAGTTCACCTACCCTGCGGGCTATCTGCTGGACCCAAAGAGCGAGTTGTTTGAGCGCATTCACGAGCTGCGCGAGGACA
TCGGCCGTCTCCTGTCACAAACGCACAAGTTCCTCAGCGAGTCGCAGGAAGACGACGTGACCTGCTTTACAGCACTGTAC
TCTACCTACCGAACATGGATCACAGACGTCGGATTCGAACGGTCGGCACACCCGCTGGATCGCCTCCTGCGGCTCTACAG
GTCTGACACAGCGTCGTTCAAAATCAACGGACTTCGAAAAGCATACCCGAGGGCTCTATTGGTCAAACGTGCCGACGCTT
ACCAGCTGCAGAGGGTCAAGTACAACTCGACCTACCGATTGAAGAGCGACTTGGACAAGCGTCTCCTACTGGACCTTGCG
GAGTCTTGTACGTCGTTATATGCCGATGTACGCCGGGTTGCGCAGAGCTCGCAGGACTCGTCTCTGAAAGTGCTGATAGG
AGGACGTCCACTGGTCATTCCGGTTGTGCTGGACAAGCTGCGTAATGCTTTGGACACAGTCGACCACGACCGCATCAAGG
GTGCCATGTACACTCTGCTCTTCACGTCACTGGTTAAGACGTTACTGCGTGACTGGCGCTTTGCGCCTACGCTCATGCGG
CTGTACATCGAAACGGCCGCGGTGGACAAGGCATCGATCCAACACCTGTGCGCTAGCGCGGTATATCCGCTGCTCGAATT
TGGCCAAGCCTTTGAGCGTATGGTCATCTTTGATCACGACATGGTGGATGCTATCGCGCCAACTGAGAAGACCGAGCTGG
TCGAGTGTGCGAGCAAGATCGAGAGGCGACATACCTTTATTGTCGGGCGTCGCGCCAAGGTCGAGAAGAACAAGGCCGCA
TTGGGCCTTGAGCTGGCTGAGAAGGCAAAGACGACACACTGGAAGGTGGCTGTCCGCTGCGCGGTGTTTGCTAACAATAT
GTGTTTGCGCTTCGAAAGTCTCGCTGCACCAGCGTTTATCGACCTTGTGGCTAGCGGAGCGATCGACCAGCACCCGACTC
TCAGGTCGAGCTACCAGAGCGCCTTTTCCAACATCTTCATGTTCATAGACCGGCGAGCGGTTTATAACCACGACTACAGG
CTTTGGCTACTCGAAAAGGAGATGAGCAAGAACAAGCTGGAGATCCCTGTGCCTTCTGACGGCGGCGATGCAGAGTGGAC
TCGCCAGTACCTTGATTCCTTCAGCCAACAGGTTGCCGAAGGCGATGAGCCTGGTGATGCTGTCCCGGAGTATTTTGTCG
ACTCTGACTATCCAGGCTGGCTGGCTTGGGGCAAGTCGTTTGTTGCATACCGAGCAAAGCCGGCTGTGTTCGATGGGTAC
GACGAAATCGAAAAGGCTGCACGAAGCCAGATTGGGGCGATCCTCACCAAAGACTGGCTCAGACAGTGCTTCGACTACAT
GAAGCAGGAGCCGCGCGACACGCATGCGGACAGGTTCAAGGTTTCGGACGTGTCCCTGCTGACGCACATCTTTGAGCTGG
TGCACAGCGGCATTGCGGCGGTGACGTTTGACGAGGTCAAGGAATTGACGCTCGAGGTGTACGGAGACGGCTCTGACAGG
CACCAGCACCGAGCGACGGCAGAGATTCTGGCGGCGCTGCTGTCACGCGGCGTGGAAGAGCCGAGAGAATACCGCAACCG
TGCATGGGCGTTTGCGGCGCCGATGCTCCTGCATGTGATCAACGAAAAACTTACGCCCGAAAACCTGCAGTACTGGATGA
CGTGCGTGCATATGATCACAGGCCTTCGAGACCCGCGCCGGTCGCGCGAGTTGGTGCTGGGCCTCGAGTCTTTCCGGCTG
GACATGACGTCCAACGCGGCTTTCAAAGACTCGTCGAGGGTGTCGTTGCTTGAGTTTCTCATCAGCGATGCTGGCTGGCA
CTTCCGCGACGAACAGCCGATTCTGAACGACATTCTGCAGCACCTGGACCACCCGTACAAGGCAGTACGTGAAGCCATGG
GCCGCATATTGGCGACAATCTACCGCACTCGCTACTACGAGGCCTTTCCGACGGTGGCGGCGCTGCTGGAAGCTAACAAG
GAGGCGTCGTCGATCGGGATTCGGCCGTACAAGCCGTCGGCACAGTTCTCTGACACGGTTGCCGATGTCTTTAAGCGGCT
GGAGGCATGGAGGCTGGAGCGAGTGCCCGGACAGCAAGAACAGAGCAGTTACACCTCAGGCTCGAAGACGGTGCTGATCT
GGCTGGACTGGATGCTGTCTTCTCAGGAGTGCACGCAGCTGGTCGAGTTTTTCCCGGAGCCGTTTATCGATCAGCTCCTG
CACATGATGGACGTCAAGGAAGACCCCGAGCTGATGCGTCTGGCTTACCACGTGTACCGACACCTGCCCAACGTGCCGCT
GCGCGAAGGCGAGGACGACGCGTTTATTCGCAAGCTCATCGACGTGGGACGATCGGCCAGCAGCTGGCACCAGCGTCTGC
GGGCGCTAATCAACATGCAGGTGGTGTACTTCCGGCGGCTGTTCCTGACGCGGCCGTTTCGCAGCGCAAGTTGCTCTTCG
ATTCGGTGGGCGACATGCTGGCAGACTCGCAGCTCGAAGTGCGCGACTCGGCTGCGGCTACGTTGGCCGGCATGATTCGA
TGCTCACCTGGCAGCATCCGCAATCCGATCATCCAGTCGCTCAAGCTCCGCTTCCAGGAACAGCTGCGGGCGAATCCCAT
GCCCAAGAAGAAGCGGGCTCTGGCGGCAGATGAGACCGGACGCGACACGCCTGTGGACATGCAGCGCCAGGTCATCCGAC
GCCATGCTGCGGTGCTCGGCTTGGGAGCCCTGATCGAGGCGTTTCCCTATGCGACACCACCTCCGGCGTGGATGCCGGAA
GTGTTGGCACATCTTGCGACGCGCACGGCGAACGACCCCGGCGTGGTTGGAAACGCAACCAAATCGATCTTGGCTGAGTT
CAAGAAGACACGACAGGACAGTTGGACTGTTGACCAGAAGGTACTGCTCTATTCCAATGTTTTCTGCATCTCGTTTTCTT
TCTCCATGATACTGACGTTGCTGTATAGTATTTTACACCTGAACAGCTAGAGGACCTGGAAGGTGTTCACTGGAAGAGCT
ATTTTGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62