GenePrediction:GLEAN_3779 Details

Name: GLEAN_3779
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:861569..863455 (+ strand)
Length: 1887
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:861569..862508 (+ strand)
Length: 940
Type: CDS
Source: GLEAN
Position: GCSC_113:862569..863297 (+ strand)
Length: 729
Type: CDS
Source: GLEAN
Position: GCSC_113:863409..863455 (+ strand)
Length: 47
>GLEAN_3779 class=GenePrediction position=GCSC_113:861569..863455 (+ strand)
ATGGCCCCAGGCGCTTACCGGGCGTCGACCGGTGAACTGGATAGTCGCGAATATGACCGGGTGTCGTTTGAGCGGGATCG
AGAGCGAAGAGACTGGCACGGCGACGAGCGAGTGAGCCGGCACGAAGAAGACGAGATTTCTATTAGCAGCCGACGAGGAG
GTCCACCGCCACGACCGCGCGACCGATCTCCGCCCATCGACTGGCCGCCGCGGGGTAGCCGGACGTTTGAGGACGATCGG
GTAGTGCACGAGCGGCGGCGGATTGTGGACGACGACGATAGCAGCAGCCTGCAGTCTGGTCCTCCTCGCCGACGCCGAGA
GCCACCAAGACCAGCCGTGATCGATGGCGATGGGAACCGACGAGTGTTTGTGGAGAAGGAGATTGAACGGCTGACGATGC
GCGACCGGTCGCCACCGCCACCAATGGTCCGTCCGACGCGGCTGGTGCGCCGGCAGTCCAGCCTCGATACGTTTGACCGA
CAGCCGGCACGGCGGTTCCACGACCACATCGAGGAGATGTATGAACGGACACCTGTGCGGCTGGACGACGTCCGAACACG
GGTCGACGATGTGTACATTGACGTGAACGGCGGCTACCGCAAAGGTCGCGAACATGACGGCTTCCACGAGACCAGGCTGG
TGCACAAGACGAGTCGGCGCCGCCACAGCCGGAGTCCAAAGCGGCCGAGCAGCAGCAGCAGCAGCAGTGCCAGCGTCAGC
TCAGCCAGCGTCAGCAGCGGCGGTGTGGCGCTCAAGGGCACGCGCAGCGAGTACCCCAAGAAGGGCAAGACCCGTATGCC
GGCGCGACTGGTCTCGGAGCGGGCGCTCGCCGACCTTGGTTACCCCTTCATCCGGGAAGGCAAGACGATCGTAGTGCAGG
TGGCACTGGGCCAGGACAACATTGACGAGGTGCTCAAGCTGAGCCAGGACTACAAGAAGAGTATGTTGGACAAGCGAGAC
GTTGGACGTTGTGGATATTGGTTGCTAACATAGAAAACAGGCGAGAGCGAAATGGTCGAATCCAAGACGACAAAGATCAC
AAAGATAACCACAGGTGGTGGTAGCCGAGGCGGCAAGGTGGTTGAGGAGGAGCGACGGGAGGAAAGGCACCGCGATGATG
TTTACATGACGCCAGCTATGTACTCACCGCCGCCGATGGCTCCGCCTCCGCCTTCGGTCTATGCACCGCCGCCCGGACCG
CCGCCCAACTACGTGTACCAGAACGAGGTGCCTCCTCCGCCGCCACAGCCTCCACAACCAACAGAATACATGACGACGAT
CAAGATCCGGGACGACTCGCCGGAGCGCATGTTCACAACAGCCGCGACAGGACCCACGTCGAACTCATTGGCCCTGGTGC
AGCCGACATCGCGATCGCTGGCTCCGGTGGTCATTGATGCCGGCGGTCCGTCCGAGTACTCCGCCTACTCGACCTACTCG
ACCTACGGGGACGACTATCCGTCTGGGCCGGCGACCATGATCGTCGATCGCCGCCACCGTCGGCACCGGTCACATTCGCA
CTCGCACTCGCACTCGCGCTCGCACTCGCGCGGCGATGGCGCGCTCTACGCCCACGTCCACGACGGTTATCACCACCATC
ACCACCACCGTGACCGCGAGCTGGTGCGGACGGAGCGGCTCAGCACGGGCGAGCTGGTCGTGTACGAGGACGAGGTCGAG
CGGATCGTGGAGCCGCACCGTGGCGTGCGCATCGAGAAGGACAAGAAAGGTAGGATGGCGTTGAGCGTGCCCCGATACCG
CTAAAGGTGTGCGATTATCTCAATTTCTCTACTTTTGCTGTTCTACAGTTTCATGCTGACTGATCATTTTGTCTGTTCAG
GTCCACCGCCGGCTCTGATGAGAGCCATGCTTGCGACCTTGACTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62