GenePrediction:GLEAN_377 Details

Name: GLEAN_377
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1388862..1393801 (+ strand)
Length: 4940
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1388862..1389357 (+ strand)
Length: 496
Type: CDS
Source: GLEAN
Position: GCSC_167:1389426..1393801 (+ strand)
Length: 4376
>GLEAN_377 class=GenePrediction position=GCSC_167:1388862..1393801 (+ strand)
ATGCCGTTCCTCCGTCGGCGAGGCGTCATGGCCAGCGAGTCTGACATGCGCCGGCACACCTCCTTCTTCAATCCGCTGGC
CATCTCCAAGCAGGCATCACCACCGCCAATACGTCCCGAGACGGCCATCCCCGAATCGGAAGTTCGCAAGTACTCGATCC
AGCTTCCTCGTTTTTCCAGCAACGTCGTCGCGGCTGCCGAGCAGGATCGCGCCAATGCTGGTGGCCTGGATTCTCTCTCT
CTGAACACCATTGCGCCCTCTTTTCCCGCACCGCCCATCACCCCTCCGGTCGACAGCATCCACCAGGGCGAGGCCACCCG
TGGCGCCATGTCCATCGAAAGCGATATGGACAGACCCGAGTCCCCTCCGATCCAGGAGCAGACGCCCAAGCACCACCGCT
TCTCCATTCTACGCTTCCGCAATGCCTCGGACTCCCAGCTGGCTGCCAGGGCCCGACAGCAGGCCCTGGCCGAAGAGATG
CCCCCCATGCCTCGCCGTATGTGTCTATCTGTATTTCAAGACCCCGCTGCCTGTTGCTAACGCGCTGTTTGTGCGCCCCG
TCAGCCCCCGAAATCATCACGACCGCACCCACTTTGGAACTAGGCTCTGCGGCTGAGCGACTGCCTGGGCACAGGTCCGC
TGTACGTGTCCGAAAGTCCGGCGAACTTGCACGGATAGACGACGAGGGCACCCCTGGCGGATCTGGCACTAGCTTCCGGA
GCTGGCCGAAGAGGGATAGGCGCAAGTCGATGGTTGTGCAGTCAACAACAGACGGCAAGCATTCTGCCGTTGCCTTTGAT
GAGTCGACTTTCAACCAGCACGGAAATCCGATGCTCCCCGAATACGGCGACGACTCCGGATCGGCGCTCGCTCTTCCTGC
TACCCGGCTCTCCGAGTCGTCTAGGTCTGACGGCAGCTCTGCCGATCGCGTCTACGGCAGTACCACCACAACCACCCACA
CCGTTCAGACCACAACGACCTTCTTCCGCCTGCCGCGTCGCAAGAACGCCAATCCACCACCCCTTTTCCCCATCGGCCAC
TTGCCCCAGAAAGGACGGCCGATCACTCCCTCCGATACACCGGTGCCTGCCAAGCGCTCGTACGAAGGCAGCACGCGCAA
CGACATCTCGGCATCCTCACACGCCGGCGGGCTCTACGTCCTTGGCGAAGGACAGTCGACGCCGACACAATCGCGACCGT
CGTCCCAGAACAAGGCGTTATCGACCCCGTCTGGAGTCGGACCATCTCCAGCTCTCGTTATCTTCCAGAAGGGAAACCAC
TCGCCAGCGTCTGCATTCTTTCGCCCAAGCTCGCGAAACTCGGGCCGCTCATCGCCGACACGCACGACTCCTGTGCCTTC
GTCTGCCGCAGCTATGCATCTTCGGGGACGATCGTCTACCCTGAGCTCTCTGGGCCGAGACTCTCTCGAAGGCAACCACC
CTCCACCCACCGTGAGGAGTTCATCTTCTGCCACAGGCCGCAAGAGCTTTGGCGACCTGCTGGGATTTAGCCGCTTGAGA
CAGAACTCGGAACTCTCTGTCCGCCCAGGCTCACTCGCTCCCGGCACTCCCTCGAACAACTCGCTTCATTTGCCGCGGGA
CTCCATCACCCTTCCTGAACGGCGGGACGACGATACGCCAGCCAAGTATCTGGCCCGTCTGGAAGAGGTTGTCAGTCGCA
GCGTGATTGCCAGCGCATTATCCAAGTCGGCCGACCAGTTCTCCCAGGCCGTTCTGCGCAGCTACATGCGCAGCTTTAGG
TTCTTTGGCGACCCAATGGACATGGCCATCCGGAAGCTCCTCATGGAGGCTGAACTGCCAAAGGAGACGCAGCAGATCGA
CCGCTGCCTGCAGGCCTTTGCAAACCGCTACCACGAATGCAATCCAGGGATCTACAATTCGCCGGACCAAGCATATTTCA
TCGCATTCTCGCTGCTGATTCTACACACCGATGTCTTCAACAAGAACAATAAACACAAGATGCAGAAGCAGGACTATCTC
AAGAACACGCGTGGCGAAGGCATTTTCGACGAGATTTTGGAAGTCTTCTACGACAACATCACGTACACGCCTTTCATCCA
TGTCGAGGATGAACTTGACATTAACGGTGATCGCATCATCACCCACAAGGCTAAGCGAAAGTACATTTTCCCCAACGGGA
ATGTGGACATGGCCAAGAAAACATCCAAGGAGCCCATTGACCCTTACACGCTCATCATCGACAACAAGCTGGACATTCTG
CGGCCCAATTTCCAGGACGCGATGCAGCTCGAAGACCCTTATAGCTACATAGGCACAGCAAGCTCGCTGAACATGAAGGA
GTTGCAGAGTACATTTTTCCGTACTGGCATTCTCCAAATCGTCTCGGCGCGGTCCCGGCCCGATGCCTTCATGACATTGA
AGACAGTCACGAATCCGGAGGAGGCCCATCCAGGCATCGTGGACATCAAAATCACAAAAGTGGGCTTGCTGTGGCGCAAA
GAGGCCAAGAGGAAGAAGGCACGGTCCCCGTGGCAAGAATGGGGCGCCATACTGACTGGGGCCCAGCTGTACTTCTTCCG
CAACACTACGTGGGTAAAGAGTCTGATTCATCAGTATGAGGGACATGTTCGGCATGGCCATGACGGCATCCCCGTTATAT
TCAAGCCGCCACTGGAAGAGTTCAAGCCCGACGCACTGATATCAACCGACGGCGCCGTTGCCTTGTTGGACTCGTCCTAC
AAGAAGCACAAGCATGCGTTCACATATGTGCGTCGCGGGGGCGATGAGGAGGTGCTTCTGGCGGACAACGAAGAAGAGAT
GAACGACTGGCTCGCGAAGCTCAACTATGCGGCTGCGTTCCGGACGTCTGGCGTCCGCATACGCGGCGCCATCGGCAGCC
TGTACGAGGGCCAGAACAGACGGGTGCTGCGGCGTCTTGGGTCGGCCGAGGGCCAAGCGGTGCAGACTCCAAGCGGCGAG
GTGACCATTACGCGCAGCCGGATCGACCAGAAGATGGCGGAAGATATATTGGCTGCACGCCGCGACATTATGCGACAAAA
GGTTGCCGACGCGAACGAGAAGCTGGCAGGCGTAGAGAAGAAGCTGGAGGTACAGCTGCGCAACTCACGACATCTGCAAA
TCATGTCGCCCATTCAGCCCAAGACTCGCGAGCAGATGCTGCACTCGGCCGCCCGCATGGCCACCCAGGTACAATGGACG
CGGGTGGAAATGTGGCGTCTCAAGTGCCATCGTGATATCCTGGAGATGGATCTGGACGAGGAGCACCAGGCTGTCGGGCT
AGGCTCAGAGCACGCACTGGAAAGCGGTGCCGCCCTTGCAGGAGCGGTAGCAGTGGCCCCCGGCTTGGGAGGAGTGGCGG
CCGAGGGCTCCTCGTCTACGGTAAATCAGCTGGAGCAGAAGCCCGGTCTCAGTCGGGAGGACTCGCTGGCCAGTTCGGCA
AGCACAGTGCTGCAATGCAGCCCAAGGCCAACGACCCATTGTGGCTCTCTTGCCAGTGGCAGCGGTGGCTCTGGCAGTGT
GATCGGTGTCGTTACCGATTTGCCGCTGTCAGACGCTTCCGCGACACCATCAAGCGCCACGCCAACGGTTTCGACACAGC
ACAATCGTCACAAGTCGGCAGAGCACACACCTACGACTGCTGGCAGCCCTGGTGTGCGGAAGGCGTCAGTCTCCAGTGCG
GTGTCCGCCGGCAGCCATTCAGCCCTGGTGACGCCTTCGCGCGCTGCACGGAGGCCGAGTCTGCCGAATGAATCGACGTT
GCAGCGCCAGACTCCGACGACGGCAGTTCCCGCCGAAGACTCGCAGCTGGACCACACGCCGGAGCCGAACGACGAGGATG
CGGATGAGCAAACGCTTCTCCAGAAAACCGGACTCCTGGAGCCTGGACTGAGTCTCGTGGGGGCTGAGGCCGGGAGCGGC
AGGCCGGCACTGGCCGAAGAAAGCAGCACGCCGTTAGCAACCGGGACACAGCACCACTACCCGGCCTCACTACATAGCCT
GCCGCAGGCCCAGGGCATGTCCCAGCAGTCGTCCCCGTCGCAACACGACAAGAACAAGATTCGGCGCAGCCTACACCGCA
CTCTCAGGGAAGGTGCCGGCCACCTTTCGCACCACCGAGGCAAGAAGACAAGGGAGACGACCTCTGCTGGTGGCTCTGAT
GATGCGGCTGGCGAACCCGGCGTGCTCGAGCGTGGGAGCGGGTCGTTTGTGGTGCACGGAAAGAAGGCATCTGTCATCAG
CTTTGGCGGCGATTTGCAGTCGATTTTGCCGTCAGACGAACGTCTGCGGCAGAGAATGTCGCTCCAGCAGTCATCGATGA
CGACGGGGAATGGTCAAGGCGATGCAGCGCAGTCGCTGGCGGAAGAAGCCGAAGGCGAGGGCGTTCGAGGTAGTACGCCT
GCTGGGAACAACGATTTCCGGGCAATGGTTCTCCAACACGATCGCAATCAAGAACGACGAGAGTCTGCAGCCAGCACCAG
CACAGCGACAGCTCGCAGCTTCCGGGAGCTGCACAAAAAGTATTCCTCCGTCCGGGCAGCGAGCAAATCGAGTACGGGTG
GCCGGTCGGCATCGCGTCGTGACGATGGCGAGAGTGAGGCCGCAGTGAGCAGTGGGCTGGAAGGAGGGCACACGCCGCTC
ACACCAGCCCTGGAAGAGTCAGAAGGCAGCGGGGAAAAGCACTTTCCTAGAAGAGGTAGAGGGAGGATGGCTGACGACGA
GAGCCAGGACGACTCTGACGCGGTGACGGATGACGACGAAGACGACTACGACAACGACAGCATCTATTCAGTCAACGAAG
ACGTGCCGTCGCAGTTCTTCACGTCCGAACCGCCGGCGTCTCCGCGGGCGAGGACACCGGAAGTGGGAGACGATGAGTCA
GCATTGGAGCTTGACAGCGGTTCTGCGACAGGACTCGCGGCTCAGACCATCCACGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62