GenePrediction:GLEAN_3781 Details

Name: GLEAN_3781
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:870713..872834 (+ strand)
Length: 2122
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:870713..870726 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_113:870935..871072 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_113:871128..871230 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_113:871282..871431 (+ strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_113:871815..872346 (+ strand)
Length: 532
Type: CDS
Source: GLEAN
Position: GCSC_113:872425..872834 (+ strand)
Length: 410
>GLEAN_3781 class=GenePrediction position=GCSC_113:870713..872834 (+ strand)
ATGGACCATTTCCGGTCAGTGCACGGGAAATGCCGAGATCCCGCTTACTGAGAATGGGATCAGGCAGTCTCGCGGGACAG
GTACGATGTTGGTCGGGCCTGGAAAATTAATTGACCCCGCCAAACTCGCTCATGTATTTTGCAGCCCTCGGAAGAGGGCG
GTCGATACGTTGGAGTTGCTACTCGGCCAAGAATGCAGAGATGACTTGGAAAGCAAAAACAGACTTACCATCACCGACGA
CATCACGGAGTGGGATTACGGGGCGTATGAGGGGGTGATACCTGGCGACGTCAATGTTCGAAGAAAGGAGCAGGGCCTGG
GAAAATGGAATATCTGGATCGAGGGATGTGAAGGCGGCGAGTGAGTCGGATAGGGCGATGGGAAATTGGCGACCACAACG
CTGACAGCCGCCTAGGAAGCCTGATCAAGTAAAAGAGAGGCTCGACCGGCTTATCGAACAGATCACAGAGATCCAAAAGC
CCTTCATTCATGGCGGGCCGGCCCCAGATGTCATGGTGGTATGCCTCCTTCACGCGCTGACAACAAGCCCTGCTGATAAA
ATCCAATAGGTTGCCCATGGCCATATACTTCGCGCTTTCGTCAAGAGATGGCTCAAGTATCCGATGGATTTCGAGTTTAC
AATGATGATGGAGCCGGGTGCCATTGGCATTCTCAGCTATGCCCACCACAATATCGAGGAGCGTGCCCTTCTGGTTGGCG
TGGGTTTCCCAACATCTGCTTGATGGTAGTTTGCCTGGACCGAGCCGCTTCAAACCCCCCATGTTGCAGTGCAGCAGTCA
TGAGTCCACAAGCTACGCGTTCATAGAATAGCTGTGATTGGAAAAATCAACGATAACTTCAGATGTTACCATTGGAGACC
TTAGACTTTTCACTCAGAGCCGGTAATTCGGCTTGTCCACTATCTGACTGACCCGCATGGAACCGAGTCTTGCCGACGGC
TGATCCTGAGAGCTTGCTTTCAATGCGGGGGTTGCATTATCTGGCTTCGATGATCCATAGAGCCAGGTCGGCACGTTATA
ATTGACCCGCCAGCACCTCCTCATCTGCCCTCACCCCCCCTCCTTGTTGTCACATAGTATAGTCCTTCAGACTCATCCTC
ATGTTGCGCAACGATATCGCATTTACTACCACGGACGGCGTTGTCCTCAGTGGCTGGTTTTATCGGCCGGCTACGACGAC
AGTGGTGGTCGATCAGCCACTGTCCTGTGTCATCCTGTCCCACGGCTTCTCGGCGATCAAGGATATGGGTCTGCACGGTT
TTGCCAGCCGCTTTGTGAGCAGCCTGGAATTGCCTTGTCTTGTCTACGACCACCGTGGCTTCGGAACCAGTGCCACAGGT
GCTGGACAGCCCCGTCATGAGATCCTCCCTGATCAGCAGATTGCCGACATGCAGGACGCCATCACCTATGCCCAGAGCCG
TGCCGATGTTGATTCCGACCGCATTGCCGTCTGGGGCAGCTCCTACAGCGGTGGTCATGTTCTGCGCATCGGTGCCATTG
ACCGCCGTGTTCGTGCTGTTGTGAGCCAGGTTCCCTGCGTCGATGGCTGGGCCAACTACTACCGTCTCGTGCGGTCAGAC
TTTGCCGCGAGCATGAGTGCCGCTTTTGCAGACGGTATGCTTACAAGTGGAGAGAGCATTGAGCCTTCTCTCGAAGTGGC
TCAATGCCGCTGTATCTAACATAACGATGCAGACCGCATCAGTCGCGCTGTCGGCAAGCCACCCACCACAATTGCGGTTG
TCGACAAGGATCCGCTCAAGCCATCTGCCCTGCAAACGCCTGACAGCTATGTCTATTTTAGCGGCTGGGGCACACACTCA
TCCTGGCAGAACGAGGTGACTCTGCGCAGCATCGAGGCCATGCGCGCCTACAATCCCGCTGCGGATATCAGCCGCATTGC
ACCGACGCCGCTGCTTATGCTTGTAGCTGACAACGACGTGGTGGCCCCTACGGATTTAGCACTGGAGGCCTACTCGCGAG
CTCACGAGCCCAAAGAGCTGCACCTCTTTCCGGGTGGTCACTTTGATGGCTACGTGGGCGACAAGTTCCAGAACAACGTG
AAGCGGCAGATCGACTTTTTGCAACGGCATCTTCCGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62