GenePrediction:GLEAN_3783 Details

Name: GLEAN_3783
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:878302..879349 (+ strand)
Length: 1048
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:878302..878589 (+ strand)
Length: 288
Type: CDS
Source: GLEAN
Position: GCSC_113:878671..878775 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_113:878843..879349 (+ strand)
Length: 507
>GLEAN_3783 class=GenePrediction position=GCSC_113:878302..879349 (+ strand)
ATGACGCTCACAGAGGGAAAAGCATACAGTATCGAGCAGGTTGAAGCCGCATTGTCGGAAAAGACATCTAATGGTGCAGA
TCGCGGCCTCAACAGTTCAAATCAGCCACTTTACAATGACAAGGAAACAACTAGAGTGCTTCACAAGGTTGACTGGCGAT
TGGTACCAGTGTTGACCTTGCTATATACAGTTTCTTTTCTCGACAAGGGTAACATTGGGAATGCCAAGGTTGCAGGCATG
ACTCGTGATCTTCACATGACAGGCACGCAGTATAATATTGCTCTAACGGTTCGTTGACCTCCTTCAGGGCACATGAAGAA
ACTTATATTGAATCATTCGGATACTTACTGAACATAAATCTTCGTACAGATGTTCTTTTTCCCTTATGCCGTATTTGAGA
TACCTAGCAACATAGTTCTGAAGCTTATGCGGCCATCCCTGTGGCTGACTATTCTTGTCATTGCGTGGGGCATCGTAAGT
GACATCTGCATATTCAACTGATCTCATATCGCTCTCTCACGGAAACATCTAATGTGAATAGGTCATGACCTGCCAAGGAA
CCGTGCAAAACTACCATGGTCTACTCGTCACTCGCATCCTCCTCGGCTTCTTTGAGGCTGGTTTCTTTCCTGCCAGCACT
TACTTGCTCGGCGATTGGTACTGCCGCTTCGAACTTCAATGGCGTCTGTCTGTTTTCTTTTCCGCGTCATCTATGGCTGG
AGCCTTCTCTGGGCTTTTGGCTTTCGCAATCGAGAAGATGGATGGTATCGGGAAACTCGCAGGCTGGCGGTGGATTTATA
TCTTGGAAGGAATTGCGACTGTTTTGATCGGATGCGTGATTCCTTGGATCTTGCCAGACTCGCCTGAACGGGCATCATTT
TTGACCTCGCAGGAGAAAGAATTTATCAGAAATCGCCTAGAGCAGGATTCTGGTACGTCATCCGGGAGAGTTCAAACAGC
GGACCCGCTTAAGTGGGCATATGTCTGGGCAGCTGTTCTGGACTGGAAGATCTGGTTTACAGTTTTCATCTACTGGGGTA
ACACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62