GenePrediction:GLEAN_3784 Details

Name: GLEAN_3784
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:881304..883438 (+ strand)
Length: 2135
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:881304..881388 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_113:881586..881811 (+ strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_113:881870..882177 (+ strand)
Length: 308
Type: CDS
Source: GLEAN
Position: GCSC_113:882342..882632 (+ strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_113:882798..883438 (+ strand)
Length: 641
>GLEAN_3784 class=GenePrediction position=GCSC_113:881304..883438 (+ strand)
ATGATGCAAAATGTGACCGATGTACCCGCAAAGAACTGGACTGCGTTTTCCAGGAGCACCGGCGTGGCAGAAAGCCAGGC
ACAAGGTTGGTGGCGCTATTACTGACAACTATGAGAAGTAACCGTGTATTCACTGACCGCAAGACTGCAAGACTGCAAAG
GCTCACACCAGCAACACGAACATCTTCGATATCTGCTCAACCATCCCCTGTGACGCCCTCGCAGTCATCACGATTGAACG
AATCCCCCCCTGAAGCAATACCCTCGACAGAATTTACGACAGCAACAGCGGCTGCGGCACGAGCCGTCGAGGAGCGCGGC
AATAACACTCTGCAGCCCTACAGCCTGTTCAGCCCTGCTGCCACACAAGGAAGCTTTAGTCTCAACACCGTATTCGACAA
CGATGCCGGCCCGGTGGGATTGCCCGGCCACGCCCCCTCTATGCCGGCAGAAGACCCGGTTCGTCTGAGACTTGTCCATC
AATCCGTGGCAAAGTCGCTGTTCGACAAGTATGCAGTCCCATATCGTGCAGTGGCGTGCAGCTTTTCGGCATTAGCTTAC
CCTTAGCTTCATGAGCATCCTCAATCCCTACATCAGCCAGTTGGATCCAGTGTTGCACACCTTTGAATGTGTCCAGCAGC
AGTCTACGCTTCTTTTCAGCTCCATTCTATCAGCCGCGGCCAAGTCGTTTAACCCAGCACTTTACACCCGTCTTCACAAT
CATGCAGAGACTTTACTGGCTGATAGTTTCCGGCATGGCCACAAGTCTACCGCAGTCATACAAGCCATCATGATAAATAC
ATACTGGAAGGAGCCAAAGGACACACGGGCGTGGACTGCTCTGGGATATGCAATCCGTCTGGGCATGGATCTCGGTTAGC
ACAAGTTGGTACCATATGCGTTTCGTCATCGTGAGTCTTTGACGGATTTGCAGGTGAGAGAGGCGCGGAACGTGGAGCGG
ACATGGTTCACCTTGTTTGTCTACGACCGGAGGTAACAAACCACTCTACTATCATTATCTTTCTGCACGGTGTGTAAGCT
AATGAGTGCAGCATAAGCCTGCAGACCGGCAAGCCCTGGATGATTGAGCGGGACACATTTATGGAGTCGATCAATCCTTG
GTGCAAAGACCCTCTTGCAACGGCCAACGATGCGCTTTTGGGTGCGTTCGTCACGCTGAGGCTATTGAGCTCAGAGGTGT
TTAAGCTTCTGGGCCCCAAACCTTGGAGTAGCCACGGCAGCTGCGTTTATAATTTTGATTCGCTGCTGGCCATCATCCGT
GGCCGGATCGAAGAATGGGAGGCTCGCTGGATTGCGTGTGTCGACACAGGTATGTATTTGCCTTGTCTGATTTTTGTCAG
AATATTCGTTGTATGCTGTGGTCTGACGAGAACAAAAGAGAGCTGTCATCCCTTTCTGATACATTTTTATGCAACACATC
TGCGCTTGCAGATATTTTCCCTGCCGCTGCAAGACATCCTGTTGCTAAAAAAAGCCGACATCTCGTCAAATCTTGAGATC
TTGTGGGTCAGTTATTCCAGCGCTATGAACATGCTGAACCTGGTATGTCGCTTCGCCCCCCGGCTCTACTTTGCGCAGGA
CTCTGTCCATATTATGACGGCGTACAGTGCTGCATTTTTGGTGAAGCTGTTGTTATCGGCCCCGGAGTCGATCGTGGCCG
AAATAGAAAACAAGACGGTCGCTGCCATCTGTGCGTCTGGACAAGCATTCTCACAGCAAGCCGCGCCTGATGGTTCTAGC
TGTGCTCTGCAGGCTAAATTTCTCGAGAAGGTTTTGTCAAATTTCAAGGAGAAAAGAGGAGAGCAGCCGTCGATGAGGGA
GATGGACAGCATCACTGTTCCACTACAGCAACCTGAACGGAACAAAAGCGGAGACACGGCTTCCGAGTCGTACAGACAAG
CACAACAACCCCTGTCCGCCCAAGGCATAGCACTGGAAACAGAAGAGCGATCTACCTTTCTCACCGGCACCGTGCACGAC
GGATTGGACTTGTACCAGACGGAGCTGGAAGCAGCTCCGTCTGACTATTTTGAATGGGCAGATCTATGTGCCAATGCTGG
TTTCAGCATCCAAGACGGTGTATTTTTTGCGCGAGAAGACTACGACGCAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62