GenePrediction:GLEAN_3785 Details

Name: GLEAN_3785
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:890024..892823 (+ strand)
Length: 2800
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:890024..890093 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_113:890165..890771 (+ strand)
Length: 607
Type: CDS
Source: GLEAN
Position: GCSC_113:890844..892634 (+ strand)
Length: 1791
Type: CDS
Source: GLEAN
Position: GCSC_113:892805..892823 (+ strand)
Length: 19
>GLEAN_3785 class=GenePrediction position=GCSC_113:890024..892823 (+ strand)
ATGGCAGATATTGACATTGACGATGTGCTTGCAAAGCTCAGCGTGCCAGAAAAAGTCGCCCTGACTTCCGGTAGGTTCTG
TATTCTGTCATCTCTTCTTGTTTGTCCGCATGTAAAGCAAGAGATTGCTCACTGATAATAGGGATCGACTTTTGGCACAC
TGTGTCCGTTCCCAGATTGGGGGTTCCATCCATCCGTATGTCGGATGGCCCCAATGGAGTCCGCGGCACGCGTCTCTTTA
ACGGCATCCGGTCGTCCTGTTTGCCGAGTGCGGTAGCACTGGGGGCCAGCTGGGATGTCGAACTTATGGAGGATCTCGGT
CAACTCCTTGGTAGAGAGGCAAAAGCCAAAGGGGCCCATGTCCTCTTGGGCCCAACGATCAACATCCAAAGGTCGCCCCT
CGGTGGCCGGGGCTTTGAATCCTTCTCCGAGGACGCCGTGCTGTCGGGAAATCTGGCAGGACACTATTGCAAAGGAATCC
GCAGTGAAAAAATCATACCGACACTGAAGCACTTTGTATGCAACGACCAAGAACATGAGAGAAAGGCAGTCAATGTGATT
GTCACGGACAGGGCCCTAAGAGAAGTCTACCTTCTTCCCTTCCAGATTTCCTTGAAGCTCTCCGGTGCGGAGGCGATCAT
GACGTCATACAACAAGGTTGGTGGCATTCACGTCAGTGAGCACAAGGAATTGATCGACGGCATTCTACGAAAGGACTGGG
GATGGGATGGAACCGTGATCAGTGACTGGTGAGCATACGGTCTCCCCTATCTGGCTTGGAATGGAAAGCGGCTGACGCTA
TGCAGGAACGGCACATACAGTGTTAGTGAAGCCATCAATGCAGGGCTAGACCTGGAGATGCCGGGACCTTCACGCTTTCG
GCAGAACGCGCTTACTGCGTGCGTATCCTCGAACAAGGTCTTACCTATGGTTCTGGATGAAAGGGTGCGGAATGTCCTCA
AGCTGATCAAGAGGGCAGCCGGTTCTCGGATTCCTGAGCATGCACCCATGCGCGAGCTCAATTCTCCAGAAGACCGCGAC
TTGCTTCGCCGGGCCGTGGCTGAGTCGGTAGTACTCCTCAAGAATGAGAAGAGTATCCTGCCCCTCGATCCCAAACGATC
GGTGGCTGTCATTGGCCCCAACGCGAAGGCAGCGTTTACATGTGGTGGAGGCTCGGCATGGCTGCCCGGGTACCATTCTA
TCAGCCCTCTAGAGGGAATCACATCGAAAGTTCAGAGGGATAGCAAAGTACAGTTCTCACAAGGAATTACCTCCTTCAAA
AAGCTCCCGCAATTAGGCCCACACTTAACCACACCCAAGGGCGAAGTTGGATTCATCTTTCGAGCCTACAATGAGCCGCC
ATCGGTGAATAGTCGCCAGGTTGTTGATGAGTTGCACCTGGAGGCTTCAAAGGCCATTCTCTTCGATTACACGCCTCCTG
GTCTTCACCCTACAACATTCTATGCTGAGGCTGAAGGTACGTTTACGCCGACAGAGAGTGGTATGTATGACTTTGGCGTC
ACTGTCGCGGGTACAGGACAGTTGTTTATCGACCAAGAGCTCGTGGTCGACAACGAGACCGTGCAGAATGCTGGCAATTC
ATTCTTTGGAATGGGGACCGTGGAAGAGCTCGGCTCCAAGGTGCTCGAGGCTGGAGTACCATATACTGTCCTCTTCCGTT
TCGGAAGTGCCCCTCTGAGCAAAGTAACGAACCCGAAAGTCGTGTCGTTTGGCAAAGGTGGTTTTTCCTTTGGTGCTAGC
CGACGCGTGGAGACAGAACAGGCCATTGCAGACGCTGTGTCCTTGGCTGGATCTGCAGAGCAGGTGGTGCTCGTGGTCGG
CCTCAACGGTGAGTGGGAATCAGAAGGATTCGACCGCCCTAATATGGACCTACCGCCACACACGGATCGTCTTGTCTCGG
CCGTTCTGGCTGCCAATCCAGACATTGTGGTTGTGGTCCAGAGCGGAAGTCCGGTCAGCATGCCCTGGGTCGATGACGCT
GCCACAATTCTCCAGGCATGGTATTCCGGCGACGAAGGTGGCCATGGGCTGGCTGATGTGCTCTTTGGGGACGTGAATCC
AAGTGGTGCGCTTCCATTCACATATCCCCGACGGGTCCAGGATAACCCGGCGTATATCAACTTTCTTTCCGAGTCTGGCC
GCGTTCTGTACGGCGAGGACGTATATGTAGGTTACCGTTATTATGACAAGGTCGATCGCCCGACTCTCTTTCCATTCGGC
CATGGCCTGTCCTACACCACGTTCTTGACATCCGAGCTGGAGGTTGCTCTCTTCGAAGAAGAACCTACCCGGCTAGGCAG
TGACGAGAAAGTCCGTGTCACTCTCAATCTCACGAATATTGGAGACCGTGCAGGAGCTGTGGTGATCCAGATATACATTG
TGCCTGCCAGAGAGACTGTGCGAAACGGAAAGGTTGACCGCCCCATCAAGGAGCTGAAGGGCTTTTCCAAGTCGTTCCTG
GACCCTGGACAAACCAAAAACATCGTGGTAGATATACCCACCAGGTTGGCAACCAGCTGGTGGAACGAGCAGAGGAACCA
GTGGCATAGTCAGGCCGGTGTCTACGAAGTCTGGGCAGTAACATCTGCGGGGTCTGTACTCAAAAAGAGCTTTGGAATGA
AATACACAAGGTATTGGAGTGGGATGTAAAATATTACTTAGCCTGGGAGATAACTGGAAGAATACATACAGCCAGATTTA
CACTTTCAGTAAGGTGTTCTTCCATTCTTGCTTCTTAACCCAGTCGATCACGGCTGTACAGGCACCCCAAAATCACCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62