GenePrediction:GLEAN_3788 Details

Name: GLEAN_3788
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:907784..909456 (+ strand)
Length: 1673
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:907784..908169 (+ strand)
Length: 386
Type: CDS
Source: GLEAN
Position: GCSC_113:908250..909456 (+ strand)
Length: 1207
>GLEAN_3788 class=GenePrediction position=GCSC_113:907784..909456 (+ strand)
ATGGCAGGACACGAGGTGTCCGACACCAAGACGGCCATGCAGGATATTGAGCCGACCAAGGTTGACAGCGAAGCCGCCCG
GCCGTCTGCCGAATGGGCGGCCGGTGACATCGCCAACGTCAAGCTCCAGGACAGCTCCCTCGACCCGGCTCTCAGGGCCA
CTGGTGGAAACATTGTGCACTACTCGGACGAGGATTATGCCCGCGTGCTCAAAAAGATTGACACGCATGTGCTGCCTCTC
ATGTGCTGGATTTACATGATCCAGTTTGCCGACAAGTCCAGTCTCAACTACTCGTCCCTGATGGGCATCAAGAAGGACAA
CCATCTGAACGGGTACCAGTACAGCTGGCTCGGCAGCATCTTCTACGCGGGCTACATTTTCTGGGAGTAAGTGAATACAC
CAGGCGAGCACCGGCCATCCGTCAGTGAGAACAACTGCTGACAACTGCCTTTCTCTCCCCTTACAGATTCCCCACCACGT
TCTTTCTGCGACGCCTTCCCCTGGGCAAGTATCTGTCTGTCAATATCGTCTGCTGGGGTGTCGTCTTGGCGTGCCACGCA
GCCACCAGCAACTGGGCCGGCCTGATGATCTCACGTTGCTTTCTCGGCGGCTTTGAGGCAACCATCACGCCTGGTTTCGT
TCTGATCACATCCATGTGGTACAAGCAGAACGAGCAGGCTCGCAGAATGGGTTACTGGCTGGCCTGCAACGGTGCCGCTT
CCATTCTTGGTTCTCTGATTGCCTACGGCCTGTCGGCTGTAAACCACTCTGCCTTGGCTCCCTGGAAGATCCTCTTCCTC
CTCTTCGGCCTCGTGACCGTTGTTACCGGCTGCTTCTACCTGTGGTACATGCCTGACAACCAGCTGAACGCCAAGTTCCT
GACCGAGGAGGAGAAGCTGATTGCCGTGGAGCGCATCCGAGACAACTTCCAGGGCATCGGCAACCGCGTGTGGAAGTGGA
ATCAATTCTGGGAGGCACTGCGCGACCCGCGCACCTGGCTCTACGGTCTCTACTCCCTGCTCATGAACATCCCCAACGGA
GGCATCACTGTCTTTGGAGGAGTCGTCATCAAATCGTTCGGCTTCGACTCGCGGACTTCACTTCTGCTCAGTGCCCCAGG
CGGTGCCGTTGATATCATTGCAAAGCTGTTGTTCCCCTGGCTCTCCGATTATTTCATGGACCGCTCTTTGTTCTCCTTCA
TTGCCATCCTGTTCCCCACGCTTGGCTGCGTCCTGATGACCGTTATTCCCCTCGAGCACAAGGGGGCTCTCCTGTTCGGC
AACTACTTGATCTCTGTTGCCGGAGCGTCTTGGTGTCTCGTCATGGTTCTGATTTCCAACAACACTCTTGGCTACACCAA
GAAGTCGACTGTCAACACTGTCCAGATTCTTGGTTATGCCGCCGGCAACTGGATCGGCCCTCAGACCTTCCGCAGCAACG
ATGCACCGCTCTACCACACCGGAAAGACCGTCATGGCCGTTCTCTACGGCTGCTCTGCTCTTGTGCTTGTAGCAATTCGG
GTCATCAACATTATCGAGAACAAGCGCCGTGACAAGGTCCAGGCCGAGTCTGGCATTGACCTCAACGACCCCGAGGTGCA
GGAATCGATCCAGAGATCCAAGTTCATGGATCTGACCGATTATGAGCAGCCCCACTTCCGATACATTCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62