GenePrediction:GLEAN_3789 Details

Name: GLEAN_3789
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:913714..914852 (+ strand)
Length: 1139
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:913714..913740 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_113:913799..913987 (+ strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_113:914053..914384 (+ strand)
Length: 332
Type: CDS
Source: GLEAN
Position: GCSC_113:914453..914852 (+ strand)
Length: 400
>GLEAN_3789 class=GenePrediction position=GCSC_113:913714..914852 (+ strand)
ATGGCTTCCACTGATGCGTTTGGATGGGTAAGAAGTCCATCTGTCCTTCGCAGTCGTCGATCTCTCGTCTGACAGCTCTC
TACAGTATGGGCTCGGTTCCATGGGCATTGGCATGGCCCTGAACCTGCAGAAGCATCTCGCTTCCAAGGGTATGTCGCCG
CTTCACTACAGCAACCGGACTCTGTCGCGAGGCGAAGCCCTCAAAGAGGCTGGTGCGATCCCGGAAGCGACCTTTGAAGA
TGTTGTCGCCAAGTCGACCATTATCTTCACCATGGTGAGTCTATTCTCCACTCGCCTTTCTTCTCTCGCGATACCCGCAT
TCTAATTGCATGATAAAAGATCTCCAACGACCAGGTTCTCGACGACCTCGTGAGCCAGGCTCTCGCCAGCTCTGCCTCCC
TCGCGGGCAAGATCTGGGTTGATACCTCGACCGTCCACCCGGACACCAGCACGAAGTGCGCAAAGCGGCTCGGGGAAAAG
GGAGCCACGTTTGTGGCCTCACCCGTCTTCGGTGCCAGTCCGGTCGCCGCCTCTGGCCAGCTCATCTTCTCCATGGCTGG
CCCGGCCGCTGTGATCGAGAAGCTCACCCCCTTCGTCGTCGGCGTGATGGGCCGGCAGATCATTAACATGGGCGAGGATG
TGTCCAAGTCGAGCCTGCTCAAGATCTCGGGGTACGTGCTGAACGAGATGGGATCGGCCAGTCTGATACTGATAAAGCTA
ACAATGGTCACTGTCGCAGCAACATCTTCGTTATCGGGCTCCAGGAACTCGTGGCTGAAGCACACGTGTTTGCCGAGAAG
ACAGGTCTTGGCACGGCACAGATGGAACAGTTCATCGGCAGCATGTTCGGGCCCGTTCTCGAAAGCTACTCGAAGCGGAT
GACTACCGGCGCTTACGCACCGCCACTCGACGTCAAGCCCGGGTTTGGCGTCGATCTGGCATCCAAGGACGCTCGCCATG
CCGTTTCCATCGCCAAGGACAACGGCACCACCCTTCCTACAATTTCGACCGCCCTGGCTCGCATGACAGCTGCCCGCGAG
TACGCTGGCGAGTCCCTGGACAGCTCTTCTCTGTATGGCACAGCCCGATTGGAAGCCGGTCTTCCTTTCTGGAGTGAAAA
CAGCAGACAAGGAAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62