GenePrediction:GLEAN_378 Details

Name: GLEAN_378
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1395999..1398185 (+ strand)
Length: 2187
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1395999..1396552 (+ strand)
Length: 554
Type: CDS
Source: GLEAN
Position: GCSC_167:1396613..1396740 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_167:1396801..1398185 (+ strand)
Length: 1385
>GLEAN_378 class=GenePrediction position=GCSC_167:1395999..1398185 (+ strand)
ATGGCGCCCTCCTGCACAGATAGAAATGGTGCTGCATCCTCCTCATCGGCGGCAGCAGCAGCCGCATCCGCAACACCACC
GCCGCTCTCGGCTGTCCCGTCATCGTCGGCAAGCCTTCTCGCAAACTACTCACCGCTTCCTCCACCACTGGCAGCTTCCA
AACACGCGGCGCCTTCTTCTTCCCGCATCGGCTCGTCCATCGGTGGCGCGTCGGCAAGGATAGCCACCACGCCACCCCCG
CCATCGGCCTATTCACGCGGACACCTGCATGAGGTGGACCGAAATACCCACAGCATTGACGGCATGATCAGCCAGTCTGG
TCCGGGCAGTCACAGCAACGCCCATCGCATCACCCGGGCCAGTGTCCGCAGCAGTCTGGGCGAGGCCGGCCGGACAAGCA
GCGGCTTTCTTGATCCAGACGCCGTCGACAGCGCTTTGCGACGCGAGCTCGGCCGCCAGACCCGACACCAGCTCGTCCCC
CCGCAATCGGCACCGAGAGAAGGCGTCCCGGGGGCAAGTCCGCATAGGAAGCGGCAGAGAATAAACGGCGACCGGTCAGT
TTCTGCTCAGACCCCCATCACCGTGTCGTGTGCTCTCTGCTGACCGTATGACAGCTTCATCCCGACGCGGTCTGGCCAAG
ACCTGCAGGCCAGCTTCAGCCTGCTGCACGAGGACGGCTCTCCGGCAACGCCGTCCAAGCAGAAGAAGCGCACACCCCAT
GGGGATCTGCACTTCCAGAGGAGTATGTATCTGCCCGGAAGCCCCTTCAGACGCGACATGGCTGACGTGACGCGCCCTGC
AGCCGAAGAAGCCAACCGGACGTTTTCGACGCTCCTACGTGCCGAGCTGTTTGAGGACTCGATACCACAGGTGACGCCTC
CATCCATGTCACCGGACCACGCGCTGCCCAGCTCAGCACGCGTGACTAACGTGCTGGACGGGACGCGCTCCCATACCCCC
CCACGCACGACCAACCCCACCTCGTCGTCGGCCGGCCCCTCGTCCATGACGCCTTCGACCCCACACAAGAACCTCTTTTC
CTACATGTCCCCCCGGCAGTACAGCCACGTTGCCGGCCACCCGACCCCATCACGGACACCGCAGAGCCGTCATGGCCCGA
ACCTAGACACACGCGCAGAGATTTACAGCCTGTCGCCGGTGCGGTTCGGCAGCCAGCAGATCCTGCTCAGCCCACGGCGC
CAGCCACGGGCGGTCAGCAAGGTTCCCTACAAGGTTCTCGACGCGCCGGAGCTTGCCGACGACTTCTATCTGAACTTGGT
CGACTGGGGCAGTGCCAACGTGCTGGGCGTGGGCCTGGGCTCGAGTGTGTACCTGTGGAACGCGCAGACGAGCCGGGTCA
ACAAGCTGTGCACACTCAGCGACGACGACACGGTGACGAGCGTATCGTGGATCCAGAAGGGCACACACATTGCCATTGGC
ACGGGCAAGGGCCTGGTGCAGATCTGGGATGCGGAGAAGGCACGGCGGCTGCGAACGATGACGGGCCACACGATGCGGGT
GAGCTCGCTGGCGTGGAACACGCACATCCTTTCGTCGGGCTCGCGGGACCGGCTGATCTACCATCGCGACGTACGGGCAC
CGGACCAGTGGCTGCGCAAGCTGGCCGGCCACAAGCAGGAGGTGTGCGGACTCAAGTGGAACTGCGAGGACGGACAGCTG
GCCAGCGGCGGCAACGACAATAAGCTGATGGTGTGGGACAAGCTGGACGACACGCCGCTGTGGAAGTTCTCGGACCACAC
GGCGGCCGTCAAGGCGATTGCCTGGTCGCCACACCAGCGCGGACTGCTGGCGTCGGGGGGCGGCACGGCTGACCGGCGCA
TCATCTTCCACGACACAATCAAGGGCACGGTGGTCAATGAGGTCGACACGGGCAGCCAGGTGTGCAATCTGGCGTGGTCC
AAGAACTCGAACGAGATCGTGTCGACGCACGGCTACTCGCAGAACCAAATTGTTGTGTGGAAATACCCGTCCATGACGCA
GGTGGTCAGCCTGACCGGCCACACGTACCGCGTGCTGTACCTGGCTATGAGTCCGGACGGCCGGGTGGTGGTGACGGGGG
CCGGCGACGAGACGCTGCGGTTCTGGAACGTCTTTGGCCGCAAACCGGGGACGCGCGACGACAGCGACGGAGGTGGCCGC
CTGGCCGACTGGGGAGTCATCCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62