GenePrediction:GLEAN_3791 Details

Name: GLEAN_3791
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:918621..922769 (+ strand)
Length: 4149
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:918621..918663 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_113:918742..918927 (+ strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_113:918992..920156 (+ strand)
Length: 1165
Type: CDS
Source: GLEAN
Position: GCSC_113:920205..921399 (+ strand)
Length: 1195
Type: CDS
Source: GLEAN
Position: GCSC_113:921471..922769 (+ strand)
Length: 1299
>GLEAN_3791 class=GenePrediction position=GCSC_113:918621..922769 (+ strand)
ATGGTTGCATCTTCTGCCCAACGGCCCATCCGGATATCCATCGGTAGGTGATTGGGACTGGGGTCGGACGATCGGATGTA
CGGATAGAGGACCAAAAGGCTGACTGTGTACTCTGCTGCAGATCGGGGCGGCACCTTTACGGACTGCGTTGCCCGCGTCG
ACGGCCAAGATGACATTGTGATCAAGATCCTCTCGGTCGACCCCCACAACTACAGCGATGCGCCGACAGAGGCGATAAGA
CAGGTGCTGCAGAAGTACACACAGAAGGAGATTCTGCGAGGGGCCGAGATCGATCTCAAGGACGTGGGTGAGTGTGACTC
GTCTGCATCTCCAGAACGATGAATAGACAAGACTCGCTGACGGCCAACCAGAATGGATCCGCATGGGCACGACGGTGGCG
ACCAACGCGCTACTGGAGCGCAAGGGCGAGCGGACGGCCTTTCTGGTCACGCGTGGCTTCCGTGACGTCCTCCAGATCGG
CAACCAGTCGCGGCCATACATGTTTGACCTGGCCATCCGAAGGCCGGATCCGCTGTACTCGGACGTCTTTGAGGTGGACG
AGCGCGTCGTGCTCGAGAGCTGTGCCGACTCGGACCTGCGCGTCCTCAAGCTGGCCTCGCCGTCGCCGCTGCAGACGGTT
TCCGGTGCCTCGGGCGAGGCCGTGCAGATCGTCCAGGCTCTCGACCAGACGAGCACGCGGGCATACCTGGACGCGATCTA
CGCGCAGGGCTACCGGTCCATCTCGGTCTGTCTGATGCACGCATACATCTACCCAGCACACGAGCTGCAGGTGGCCACGC
TCGCCCGTGAGGCCGGCTTCGAGAACATCACGCTGTCGCACCAGGTCTCGTCGCGACCAAAGCTGGTGCCTCGGGGCAAC
TCGGCCGTTGTGGACGCGTACCTGACCCCGACGATCCGCCAGTACCTCGAGCAGTTCTCGTCAAGCTTCCCCCATCTCGA
ACGTGACGGCACCCGGCTCGAGTTCATGCAGTCCGACGGCGGCCTCGTGCCGGCCTCTAGCTTGCGTGGCCTGCACTCGA
TTCTCTCGGGCCCGGCTGGCGGTGTTGTCGGCTACTCGCAGACCTGCTTCGACGACGACACCCACCGGACACCCGTCATC
GGCTTCGACATGGGCGGCACCAGCACTGATGTCAGCCGCTTCGACGGCGAGCTCGACCACATCTTTGAGACCACGACCGC
TGGCATCGCCGTTCACGTGCCCCAGCTCAACGTCAACACTATCGCGGCCGGCGGCGGCAGCATCCTCGCCTGGCGAGACG
GCCTGATGTCTGTCGGTCCCGAGAGCGCGTCCTCGCATCCAGGCCCTGCCTGCTACCGCAAAGGTGGCCCGCTCACCGTG
ACTGACGCCAACCTCGCCCTCGGCCGCCTGCTGCCCGAGCATTTCCCCTCCGTGTTCGGGCCCAACGAGGACCAGCCACT
CGATAGCGAGATCGTCGTGGCCAAGTTCCGCGAGCTGACCGACATCATCAACCGCGACACCGGCCGATCCATGAGCTGGC
CTGAGGTGGCCAACGGGTGCGTTCTATTGTCCAATAATGCTTATGTAAGCTGACACGTGACCAGGTTCCTCGACGTCGCC
AACTCGGCCATGTGTGGCCCCATCCGCAGCCTGACGGAAGCCCGCGGCTTCAACACGGCCGACCACAACTTGGCCTCGTT
TGGTGGTGCCGGTGGCCAGCATGCCTGCGCCATCGCCGAGGCGCTCGCCATCCGCCGCGTCATCGTGCACAAGTACTCGT
CCATCTTGTCGGCCTACGGCATCGGCCTCGCCAACGTTGTCCACGAGGACGAGCGGCCGTGTGCGCGGGCCTACGAGGGC
GACAACGTGCCTGTCATTGCCGCCAGCCTGGCCGATCTCAGCCGCGAGGCCCAGAGCCACCCGTCCGTCCAGCCGTTCAA
CGTGGTCGACGCCCACTGCTTCCTCAGCATGCGCTATGATGGCAGCGACACTGCTATCATGACCGCCCTGCACGACGGCG
TCGATGCGGCCAAGACTTTTGTCGATGCCCATCACCAACAGTTCGGCTTCACCCCCGTCGGCCGCAAGATCTTTGTCGAC
ACCATCCGCGTACGTGCTGTCGCTCGTCAACCCGAACCATCGCTGCCCCAGACCTCCTCTTTGCCTGTTTCTAGCTCTAT
AGCCGCCATCCCCAAGTCCATCTCGGTCAAGTCTGTCTATTTCGGTTCATCCGGCTGGACTGACACGCCCGTCTACCTCT
TTGCTTCCATCCCGGAGGGTGTCGTCATCCCCGGCCCCGCCTTGATCGTCGACAAGACCCAGACACTCCTTGTCGGCCTC
ACCTCGTCGGCCTACATCGACAAGGACCGCCTCATCATGGACGTCGACTCGCCACGCTCCAAAAATGTCAGCGCCCACGT
GATTGACCCTATCGCCCTGTCCGTCTTCCGTCACCGCTTCATGGGCGTTGCCGAACAGATGGGCCGAGTCCTCCAGAATG
TTAGCGTCAGTGCCAACATCAAGGAGCGTCTCGACTTCAGCTGCGCCATCTTCACTCCAGACGGCTCCCTCGTTGCCAAT
GCACCCCATGTGCCCGCCATGATTGGCAGCATGGCCTTTGCCGTCAAATCGCAGATCGAGACCTGGCAGGGGAAACTCCA
GGATGGCGATGTCCTTATCTCTAACTCGCCCGCCTATGGCGGCACCCATCTGCCGGACTTGACTATCATCACGCCCGTCT
TTGACGCTGCCGGAAAGGAGATCATCTTCTGGGCTGCATCTCGAGGTCACCATGCCGACGTAAGTCTGATTCCTCTCTCA
TGCTGCAGTTTCGCCTTCCCGATCCCTGTCTCATCCTGTCCTCGTTTTAGGTCGGCGGCATTTTGCCAGGCTCGATGCCT
CCCAACTCCAAGTTCCTGTGGGAAGAGGGTGCCGTATTTGACTCTATGCTTCTCGTCCGCGGTGGCGTCTTTGCCGAAGA
AGAGCTCACGCGCATCCTCTGCGTTGAGCCAGCCACGAAGCCGGGCTGCAGTGGCACTCGCTGCTTCCAGGACAACGTCA
CCGACATCAAGGCCCAGGTGGCCGCCAACCACACCGGCATCCGTCTAGTCCGCCAGCTGATTGAGGAGTACACCATGGAC
GTCGTTCAGGTCTACATGAACGCCATCCAGGAGTCGGCCGAGCTGGCCATCCGCAACCTGTTCAAGAAGCTCGCCGTCCG
CTTCAACGGCCACGAGCTGTCTGCGGTCGACTACATGGACGACGGCACGCCCATCTGCCTCAAGGTCACCATTGACGTCG
CCACCGGCAGCGCCCAGTTTGACTTTTCCGGCACCGGCCCCGAGGTCTACGGCAACTGGAACGCGCCGCCGGCCATCACC
AACTCCGCCATCATCTACGCTCTCCGCTGCATGGTCGACTCTGACATCCCGCTCAACCACGGCTGCATCAAGCCCATCAC
CCTCGTCCTGCCCGACCGCTCCATGCTCAAGCCCAGCTTCGAGGCCGCCGTCTGTGCCGGCAACGTCCTCACGTCCCAGC
GCATCGTCGACGTCATCTTCCGGGCCTTCAAGGCCTCTGCCGCCAGCCAGGGCTGCATGAACAACTTCACCTTTGGCCGC
GACGGTGAGAACGGCTTCGGCTACTACGAGACCATTGCCGGCGGCAGTGGTGCTGGCCCGACTTGGTCCGGCACCAGCGG
CGTCCACACAAATATGACCAACACCCGCATCACCGATCCCGAGTCCCTCGAGCGCCGCTACCCCGTCGTCCTGCGCCGCT
TCTCGCTACGGCCAGGCAGCGGCGGTATCGGTGAGTTCTGTGGCGGCGACGGCGTCATCCGCGACGTCGAGTTCCGTCTT
CCCATGTCCGCTTCCATCCTCTCGGAACGGCGCAGCTTTGCACCCTATGGCCTCGATGGTGGCGGTGATGGACAACGCGG
CCGCAATACCTGGGTCACCACTTCAGGACGGACGATCAATATTGGCGGCAAGAACTCGGTGGCTGTCAGCATGGGCGACA
GAGTCGTGATCGAGACGCCTGGTGGTGGTGCATATGGTGCGCCTGGTCAAAAGGAGCAGTCTGTGGACGCATCCAAGCTC
CAGCCATCGTTTGTACCTCTCGCTGTCGGCAGCGTGGCGGCGACCACAGCTCTTGCCGAGCAGTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62