GenePrediction:GLEAN_3792 Details

Name: GLEAN_3792
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:925862..927609 (+ strand)
Length: 1748
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:925862..926223 (+ strand)
Length: 362
Type: CDS
Source: GLEAN
Position: GCSC_113:926357..926492 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_113:926544..926673 (+ strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_113:926751..927396 (+ strand)
Length: 646
Type: CDS
Source: GLEAN
Position: GCSC_113:927447..927609 (+ strand)
Length: 163
>GLEAN_3792 class=GenePrediction position=GCSC_113:925862..927609 (+ strand)
ATGGCTGTGCTTGCCACACCCGTTCTGCTTGTTGCAATTCTGGGCACATTTATTGTATTCTTTTGGGGGCGTCTACGATC
TGCTGTCGCATCCATCCCAGGGCCGACGTTGACCTTGTTCTCGTCCTTGCCACTCAGATACCAGGAGTTCCGGGGCAATC
GGACAAGATACATCCATGATCTGCACCTGAAATATGGAAGTGTCGTGCGAATCGCGCCCAACGAGATCACCTTTGCATCC
CTGGAAGCCATGAAGGAGATATATATGTCTAATGGCAGCGGCTATGACAAGACAGAGTTCTACAGCCTGTTCAAGCAATA
CAATACGGGGCAAGATGCCCCAAGATATTCCGCCGTGATAATGTTACCAAAATCTAACGATTGAAAACAGGGTGATGTTT
TCCACTCTAGATAAGCAAGAGGCAAGTTGGTTATTGGATAATGGAACCTTGGCTCCCACAAACATGTAGCTAACACCCCA
TTTGCAGCATAGCAGGCGAAGACGTCTCCTGGCTGATCGCTACGCAAACTCCAATGTCGTGAAGGAGAAAGCTATTGAGG
GAATCCAGCAGAGAAGCAGAAACTTCACAGCGAAAGCCGCCAAAATGCCAAACCAGGAGATGGATATCTATGTATGAGAC
CCGCAGTTGATGTGCCAGGGGTGTTGCTAACTTGAAAAACAGGTGTACCTTCACTGCTATGCTTTCGACTGCGTCACCCA
CCATTTGTTTCACCCTTATGGAAGCAACTCGATTGACCAGCAGTATGATGAATCAATCATGCGCGAGGTGTCATTTGATA
CCAGCTTGGCTCGTATGTTATTGATGAAATAAATATGGAACATAGAACCCCTTATTCCTGGCTAACCTTAACTATTTTGT
CACATACAGGTCGACTTATTCAATATTACACTCCCAATCTGGAGTATCTGGCAGACCTTTTGGGCCTCCTTCCACCCATA
CGAACAATACCAAAAGCCCAGAAGCTCGTACTGGATGCAGTGGGCCAAGGCGGTGTAGCAGATTTCACGCCACTGTCCCG
CTTGCAGGATCCGAAACTCGGCCTGGAGGAGATTCAGATGGCTGCCGAGTGCATGGATCATATGGTAGCTGGTATAGAGA
CCACTGGTGACGTCTTGTGTTGGCTAATGTGGCAAATATCGCTACCGGGCTACCAGGCTATACAGGATCGCCTATATGCA
GAGCTCACTATGGACTCGGCCAATGGGGAAGTGTCATACGACCAGCTTCCGTATCTCCACGCGGTATTGAAGGAGGGTCT
GCGCATATTCCCTTCAATTCCGATGAGCCTCCCCCGTTACGTTCCCAAGGGCGGTAGAGACATTGCTGGCACATGGCTTC
CTGAGGGAATCATTGTCAGCTGCCAGCCATACACGATGAACCGGTTTGACCAGGTGGTTTTCCCGGAGCCCGACACGTTT
GTCCCAGAGAGATGGCTAGACAAGGAGGTCGAGACAGAGCAGAACCGTCTCTTCTTTACCTTTTCCAACGGAGGGCGTGG
CTGTATAGGCCGACAGTACGTTGTAACTCTATACCCCTTGTTACTACCCCCGCTGATATCGTTAGTTTGGCCATGGTCGA
GATGAAGTTGCTTCTGCGCGATGTATACTCCACATTCCGGACTGTTCTCACCGAAGAGGGCATGACGGCCGACATGTCTA
TGGCGGATCAGATCATCTCTTCGAGGCCCAAGGCCCAGAAATGCATGGTGAAGTTTATTCCACGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62