GenePrediction:GLEAN_3794 Details

Name: GLEAN_3794
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:931259..933051 (+ strand)
Length: 1793
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:931259..932780 (+ strand)
Length: 1522
Type: CDS
Source: GLEAN
Position: GCSC_113:932834..933051 (+ strand)
Length: 218
>GLEAN_3794 class=GenePrediction position=GCSC_113:931259..933051 (+ strand)
ATGCAGCAAAAGACAGCAACGACACTCCCGCTAGCGGTCGAGCGGCAGCCGAAGCGCGTCGCGAGTCGCCTTCGGTCAGC
ATGTCTGCTTCTTCCGCTGGCAGTGGCGGCTTATCTGATCGCTCCCTACGGCATCCGGCCCTTCACCTCGATAGAGGTGC
TCCCGGCGGAGTCGCTTTGCATCCAGCCGCCCGCTCTCTTCCCGAGCCAGCAAGACAAGAAGCTGGAAGAGGCTTTTGGG
CACATATCTAGCGAAGCATTCCGCAATCTCAGCGTCGCGCATCTGTCGGGTGCTGTCCAGATCAAGACGGAATCATTCGA
CGATCTCGGACCCATAGGCGAGGATGCCCGATGGGACGTCTTCGTCGGCTTCCATGCCTATCTCGAGAAGACCTTCCCGC
TCCTGCACGAGCGGCTGCAGGTCGACAAGGTGAACACGCACGGGCTGCTGTACACGTGGCCGGGCAGCGATGCCGCCCTC
AAGCCGTCGCTGCTGATGGCCCACCAAGACACCGTCCCGGTGCCGCTGGAGACACTGGACGCCTGGACGCATCCACCCTG
GAGTGGTGCCTATGATGGTCGCTTTGTCTGGGGCCGCGGCTCTAGCGACTGCAAGGACCAGCTGATCGCCGTGCTCGAGG
CCACTGAGCTGCTGCTGCAGGCTGGCTTCCAGCCGCGACGCACGATCCTGCTCGCCTTCGGTTTCGATGAGGAGACATTT
GGCTTCCATGGCGCTGGAAACCTGTCAGCCGTCATCCGCGACCGCTATAGCCACAGCGGCGGCCTCGCCGCCATCATCGA
CGAGGGCGCCAACTTCGAGCAGGCCTGGGGCACCCTGTTTGCCAAGCCGGGCACGGCCGAGAAGGGCCTGACCAACGTCG
AGGTCGTCGTTCGCACGCCCGGTGGCCACTCGTCTATTCCGCAGGACCACACCAGCATCGGCATCCTCAGCGAGCTCATC
ACCCGCATCGAGGCCTCCCAGTATCGCACCCGTCTGGACGAGCAGAACCCCTACTACACGCAGCTGCAGTGCGGTGCCGC
TCACGCTCCCGACTTCCCGCACAAGCTCAAGAGGCTGCTTGCCAAGCGTACTTCCCACAAAGGTAGTGATCACGGCAGCT
GCAGCAAGAAGCCCGACTACCTCGCACTCGAGGCTGCCAAGCAGGGCCCCCAGATCAAATACCTCTTGCAGACCTCACAG
GCCGTCGACATCATCTCGGGCGGCGTCAAGGTCAATGCCCTCCCGGAGCGCGTCAAGGCTGTCATCAACCACCGCATCAA
CGTTGGCGAGACCTCGGACGTCGTCTATGACCATTTGACTGCCGTCGCCGGAAAGGTGGCCAGCAAGTACAACCTGACGC
TCCACGCTTTTGACGGAAAGGAAGAGCCTTCGTCCATCATCCTTTCGAGTCCCACCCGACTTGATCCCTCGCCGGTCTCT
CCGGCCGACGGCTCCGTTCACGGTCCGTTCTCCATTCTCGCTGGCAGCATTCGTGCTATCTACGGCGAGGAGGTTGTCGT
CAGTGAGTATAAGCAGTTCTTCTGATTGCCAGTTGCGGCACTAACCTGTTCAAAGCCCCCGGAATCATGACGGGAAACAC
GGACACGCGCTTCTTCTGGGATCTGACCGACCATATTTTCCGCTTTGCGCCTGGGTATGATCCTGAAGACGATTCCGATA
TGACAGGCTCTGGAATCCACACAATCAACGAAAAGGCCAGTGTGGCGGGTCATATCAACGCTGTCAAGTTCTTTGTGCTG
TACATTCGCAACCTAGATGAGGCTGATCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62