GenePrediction:GLEAN_3796 Details

Name: GLEAN_3796
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:943518..944130 (+ strand)
Length: 613
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:943518..943586 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_113:943674..944027 (+ strand)
Length: 354
Type: CDS
Source: GLEAN
Position: GCSC_113:944089..944130 (+ strand)
Length: 42
>GLEAN_3796 class=GenePrediction position=GCSC_113:943518..944130 (+ strand)
ATGGATCACGGCCGCGACCCGTGCCCCTATGTCATTCTCAATGACTTTGGCGGCGCCTTTGCCATGGGTGTATGTTGCCC
CGATGCTATCTGCCCGCCGGCAGCAGCCGCCTTCCTGGCGCAAAGAGACTCGAGCTAACGATAGTCTTCTCTCCAGGCCA
TTGGCGGCACGATCTGGCACGGTATCAAGGGCTTCCGCAACTCACCGTACGGCGAGCGACGGTTGGGCGCCATGACGGCG
ATCAAGATGCGGGCGCCGGTGCTGGGCGGCAACTTTGGCGTCTGGGGCGGGCTCTTCTCGACCTTTGACTGCGCCGTCAA
GGGCATCCGCAAGAAGGAGGACCCGTACAACGCCATTATTGCTGGCTTCTTCACCGGTGGCTCGCTGGCCATCCGCGGCG
GCTACAAGGCTGCGCGCAACGGCGCCATCGGCTGCGCCGTCCTGCTGGCCGTCATCGAGGGCGTCGGCATCGCCTTCCAG
AAGATGATGGCAGGCAGCACAAAGCTGGAGGTGAGTCTCCTGCTGCCATGCCTCATGCCTCCCTGCACTTCACCCACTGA
CGTTTTTGCAGCTCCCGGCACCTCCGCCGCAACCAGAAGCGATTGCAGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62