GenePrediction:GLEAN_3798 Details

Name: GLEAN_3798
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:946287..949981 (+ strand)
Length: 3695
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:946287..946524 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_113:946606..946675 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_113:946736..947235 (+ strand)
Length: 500
Type: CDS
Source: GLEAN
Position: GCSC_113:947599..948295 (+ strand)
Length: 697
Type: CDS
Source: GLEAN
Position: GCSC_113:948526..949110 (+ strand)
Length: 585
Type: CDS
Source: GLEAN
Position: GCSC_113:949198..949981 (+ strand)
Length: 784
>GLEAN_3798 class=GenePrediction position=GCSC_113:946287..949981 (+ strand)
ATGTCGTGCGCCGACTGCTATACCGGCTCTGTCCACGAGGGCAAGCCCCGAGGCAAGACCATTGAGCTCCATGGTCTCCA
AGCCTATGTCACCGAGCCGACTGGCAATCGTGCCCCCAAAGCCATCATTGTCATTCTCCCCGACGCCTTTGGCTGGGAGT
TTGTCAACAACCGTCTCCTGGCCGATCACTACGCCGACAAGGGCGACTACAAGGTCTATCTGCCGGACTTCATGCTGGGT
GCGATGCGTCCAACGAAGCCTTCTTTGCTTGGAAACTAGCTACTGACTACAGCTGTCGTCTTGCTTTCATCCCTCACAGG
TCGCTCAACTCCAGCCGATGTCATCCCGTCCATGCGTGATCTGATCAGCGGTGGATTGTTGTGGAAGCCGTAAGGCCCTA
TAGCCTTGTTTCTCCCCCTCAGTTGTGCCCTGATATTCACTACCATCAGCTACTACCTATGCCGCGTTGCCGTCGGCATG
GTCCCCTTCCTCCTGACGAACTACATCGGTAAGTCGCATCCGCGGGTGCGCCTCTTTTTTGAGCGTCTGCGAGCGGCCGA
GGGCTCCGACGCCCTCATCGCCGCTGCCGGCTTCTGCTGGGGCGGCAAGCACGTGCTGCTCATGTCCCACGACATTGTCC
CGCTCATCAATGCCGGTTTCGTGGGCCATCCCAGCTTCTTCAGCCCTAGTGATGTCGCCGCCCCCGTCACGGTGCCCGTG
GCCGCTGCTGTGGGCAGCCTCGACCCGACCCTGCCCGCCGCCTCTGTCGATGTTATGCGCAAGGGCCTCGAGGCCGAGAC
CTTAGCCGAGGCCGTGCGTGGCCAAGTCACCGTCTATGACGGCTGCGGCCACGGCTTCTGCGTCCGTGCCGACTCCACCT
ACAACGACATCACCAAGCAGGCCTTGGCCTCTGAGGATCAGTGCATCGCCTGGTTCAATGGGCACTTTGGTCTGTAAAGG
GGTGGGATTGGCTGAAATACAGATTTGTTACCTGACATCTTGTCGTGTTGTTTAATCGTCAGTTTGATACCAGAGTCGGA
TGTAGTAGCACAAAAGTTTCTTGAAGACGAGACATCTGTCATAGTTCAACATATTGTCATTCGTCCTGAACTGAAGAGCA
GAAAAGAGAAGAGTTGTTATCGTTGACGCGGAGAGAAAAGCAGCCGACTTGCGTGGTAGCGCTTACTTGGTGCAACCTTG
TTTGCAGGTGGGGATGGCTGCGTATTAAAGGGCGCTCAGGGCCTGCAATCCAAGTCAAAAACGGTCGTGCTAGTAAAGAA
CTGTCTCTCTCTGACAATGGATGCGGCTACAGCCGACAGCAGCCTGCCTGAAAACCTCAAGGCCCGGCTCAAGGCGTCGT
ACGATGCGATTGCGCCGACATACAACGCCTGGACGATCGGGCACTCGCCCATGCGGATGCAGTACCTCGACCTCCTCATT
GCACGGCTGCAAAAAGAGACAAGCACAGGCGTCGGGCCTCTGCGCGTGGTGGAGCTCGGCTGCGGCGCCGGCGTGCCCGT
GACGGAGCGGCTGCTGACAGCACTGCGTCCGGTGCACGTTATGGCCAACGACCTGTCGTCGACGCAGATCCGCCTGGCCC
GGACCACACTGGGAGACCACGGCGAGACGGTGGAGGGTGGTGGCGGCAGCAGCGTGGACTGGCTCGAGGCCGACATGATG
TCGCTGGCCTTTTCTGATGCCACGATCGATGCCGTCGTCGGCTTCTACAGCCTCATCCACCTGCCGCGCGACGAGCAGAC
CGAGCTGCTGGGCCGCATCGCCCGCTGGCTCCGTCCCGGCGGCTGCCTGCTGGCCAACTTTGCCGAGGTGGCGAAACCGG
CCATCGTCATGGATCGCTGGCTCCACGACGACGGCTGGATGTTCTGGAGCGGCTGGGGCGTTAACGGGACGCGCGCGCGC
ATCCGCGAGGCCGGTTTTGATTTGGTCGTCGCCCAGGTCGAGCAGGACGCCGTCGATGCCAACTTCTTCTGGGTGCTTGC
ACAGACATCGTATGAGGACCATACTACAGAGTAAAATACGGAGTCGATCCAGAGCTGCGTAGATGATTACGTAATTCAAA
TAAAGCCCCACTTTCCACCAGGCAATTGGCGTATCGCGTCCCTGCCTGATTCGGGTGATGCTGACCTGTCTGCACTTTTC
TCTCTCTCGACTCCGTGCCGACATCTCCAGAAGCGTCCATTTCTCCGGCGGACGCCCTCAGCCTCCGAACAAGCGACAGA
ACCGAGATCCCCTCCTCCACCATGGTGACCGCACTGGCACGGCGGGCAGCGTTGCCGCCGTCCATCTTGGGGCGATGCCG
CCCGGCCGCCCTGGCACAGCTCCAGGCTCGGCCTCGATCAGCAGGCCTGATGACGACAGCGATGCCAGCGATGCCAGCGA
TGACGGCGACAACAGCGGAACGGCCAGCATGGCCATCTCCTGGCCAGCAGCGACGAGCGCTGCAGACGAGCGCAAGACGA
CAGGTGCCGGGCCCGTCGCCGCTGCTGGGGGCCATTGGCGGGTTTGGATCGTCGTCGGCTATCCCGGCGGCCTACTTCCA
GAAGCCGTCGCTGCCGGCCAACACGATCATCCGGTTCGTGCCGCAGCAGACGGCGTGGATTGTCGAGCGGATGGGCAAGT
TTGACCGGATCCTGCAGCCCGGTCTGGCTGTGCTGATCCCCTTCCTCGACCGCATTGCCTATGTCAAGTCGCTCAAGGAG
ATCGCGCTCGAGATCCCTAGCCAGAGCGCCATCACGGCCGACAACGTCACTCTGGAGCTCGACGGCGTGCTCTACACGCG
GGTCTTTGACGCCTACAAGGCGAGGTGCGTTTTTGTTCCTTTTTTCTACTCCCTTCCCTCTTTCCCATTCGCTCTGCTCT
CTATCTACATCGAACCCGCTAACTCTCCCAGCTATGGCGTCGAGGATGCCGAGTATGCCATCTCGCAGCTGGCCCAGACG
ACGATGCGCAGCGAAATTGGCCAGATGACGCTGGATCACGTGCTCAAAGAGCGGGCGTCGCTCAACACCAACATCACGGC
CGCCATCAACGAGGCAGCGCAGGCGTGGGGCGTCACGTGTCTGCGGTATGAGATCCGTGACATCCACGCGCCCGCCGCTG
TGGTCGAGGCGATGCACCGCCAGGTCACGGCCGAACGGTCGAAGCGAGCCGAGATCCTCGAGTCCGAGGGCCAGCGCCAG
AGCGCCATCAACATCGCCGAGGGCAAGAAGCAGAGCGTCATCCTGGCTTCCGAAGCCCTGCGCTCCGAGAACATCAACCG
CGCGTCCGGTGAGTCCGAGGCGATCCTGCTGCGCGCCACCGCCACTGCCCAGGGCATCGATGCTGTCGCTGCCAGCATCG
CTGCCGGCCGTGACGCCGCTCAGAGCGCCGTCTCGCTGTCCATTGCCGAAAAGTACGTCGACGCCTTTGCTCGTCTCGCC
AAGGAGAGCACGGCTGTTGTCGTGCCCGGCAACGTCGGCGATATGGCTGGCCTCATTGCCACCGCCCTCGGCGTCTATGG
CAAGGTAGGCGAGGCCACCCGTCGGCCCCAGGAGACCGCCCGCGCGCTTCTCAAGACGAGCGACGACACCGAGACCGCCC
GCGAACTCAGCTCCCCCCTTTCCCAGGCTTCCAAGAGCAGGGCTGTCCGCGACCATATCGTGGAGGACTTTGACAAGACT
ACGCAATCGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62