GenePrediction:GLEAN_3799 Details

Name: GLEAN_3799
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:956158..958562 (+ strand)
Length: 2405
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:956158..956233 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_113:956322..956401 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_113:956480..956727 (+ strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_113:957411..957430 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_113:957495..957679 (+ strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_113:957744..958562 (+ strand)
Length: 819
>GLEAN_3799 class=GenePrediction position=GCSC_113:956158..958562 (+ strand)
ATGGCGGTCGCACAAGTTCCGCGCAACTTCAAGCTCTTGGCCGAGTTGGAGAAGGGCGAGAAGGGGCTGGGCGCAGGTAC
GACATCCACGGATCTGCCATGGGTCTTGCAGGGCGCTGCGAAATGTCCTCTAATCACGGTCCTCCGATGCTAACAGGATT
ACAGGCGCATGCTCGTATGGCTTGGAGGATCCTGAGGACATCTTGATGACAAACTGGCGAGGCACAATCTGGGGACCACC
ACACGTAAGTGCCAGATGAACAAGCCTTCCAGACCGTACTTGCGGTCGATATTAAGGCGCTGACGCCGTCATTTGGTCGC
AGGGTAACCACGAGAACCGGATATACGAGCTTAAGATGAACTGCGGCGAAAATTACCCCAAAGAGCCACCCACGATCTAT
TTCGTCAGCCAGATCAACCTGCCGGGTGTCAATAACGTCGATGGCCTTGTGGACAAGAACTGTATCGGTATTTTGCGCGA
CTGGACGGCCATCGCGGCGCAGTTGTCACGAAACCCGCGGCCGAAGGAGGACCCTCTTAGCCTTGAGACTGCTCTGATCT
CCATACGGAAGTACGCTTTTTGGTATAGGACCTGACAGTTGTGAGACTCACTGGCTAACAAACTCTTACTAGATACATGG
AAGAGAACAAGAAACTTCCGCAACCTCCCGAGGGCTCTCGTTATGCCGTGTATAAGGACACCATTTAAAGTAGTTACCAA
GCCACTGCGAGAGCTCCGGGAGCTCCGGGATAAGCCCGAGGAGATAGGAGGTCCGACGACGACGATACCGGAAGGGGCAA
CACAGCGGGTGCGGGCATTTCAGATGGCGTCTTCGCTGTTTTACGGCTTTTTGTGCTGCTTAGACAGTTTCATTCAAACA
TCCAGTTTTATCGGCCACCACATATTTCTACTATCTCTGCTTTCTTCCCCGGTGCACTTTCACAGATGAATGCAAATGAC
CGAATGGATACGACACCATGATGCCACCTCCGTAGTGTACCTCGTTCATCTTGTGGTGACCCTGCAGCATGGAATCCGAC
GTCGTAGCAGCGGATTCTAGAACGATTCGGTGGGGCACTAATAGTATGACGCGTGCCCCTCTGGCGCTCACGTGCCGACG
TTTAATCTTTGCTCTGGCGAAAAAGTGCAGTCAACATCGACGAATGCAACCTTTGGCCTCAGTGCTGCCGCAATCACCAC
TGGCCTCGTCGGATTGCCAGATGAATGCCTTCATTCTTCATTCCCGCCCGCAGTTCGCGGCATCGAACAGCATGTCCGTC
TCCCCGTGCACAGCAAATAGCTCGCAGTCGTCTTTGCCTGTCTAACATGATCGACAGGCTTTGCGCTCTACAAAGCCCTG
CTCAAACAGGCAGCTCAAGTCCCTCTTTTAGATAAAGCAGGGTCTTCGACTTCGGGCCCGCCGATTCCTCCTATTCAAAA
ATTGATCCGGAACACATTTGAGCTGAACCGTGGGGACACGAGTCCCCGACTGGTTCTTGGAGCGTTGAACAATGGCTACA
AGGTGCGATAATGGTCGAGGCTGTCTTCTGTTCCCTCAGAGCGAGAATTGACCCGCCGATATATAGTTCCTCAACCTCTT
AGCTGAGGCGCAGACACCCTCGTCACCGGCGCATGCATCAATACTAGCATTTCTCCGGAAACCGATCGCCGCCGAAACCA
TTGCGAAGTCCACAAAGGCACCACGAACGAGATCGAAAAACAGGAAACGGACAACCCTGCCTTCTGCACCACACCCAGAC
ACGGTGCCCCTCCTCACACGGAGGACCATACCGGGCTCAGAAGAGTCCTCACCCGATAATCAGTTCACCTTCCAGCACTA
CGAGTACGTCTCGACGGCACGGCCGCGACCGCTTTCCGAACTGAGCCGCACCATAGACGGGCGGCGACGCGTGCCCAGGC
TGGCGACTGATGCCACCGGCCTGCCGTTTCTGCGCCTAGGGCGGCCCCAGTCACCCGTGTTGTCACGGGTGATCCGGCAA
AAGGGCCGCAAGAGACGCGACCGCATGCAGCTCGCCAGTGAGCTGCAGCGGGACGAACTCGATTTTGCGGCACAAGAGGA
CCTGTGGGAGGCTTCCGTAGAGAAGCTGCTGTCGGATGAGAGGCAGGAGAGCGGTTTCGGACAAGGAAGAAGAGAACCGA
CTTATGCCCAGGGTGTGTCGGCTGGCATCAACTATCTGAACGCGAAGCTGAACACGGAGATGGCCGACATGCTGGCGCGA
TCGAGAGCTATGCTACGAATTGTCGACGAGGAAAAGGCCCTCGCAGAGAAGGAAGCGGAGATTGAAAAGAGGCTAAAAAA
GAACGAAGAGAGGACGCGTTACCCATCAGCGATAGCACAGCATGACGACGGTGTTGTGCAACCCGGCGGCGGTGAACCTG
CATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62