GenePrediction:GLEAN_379 Details

Name: GLEAN_379
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1400681..1408100 (+ strand)
Length: 7420
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1400681..1401100 (+ strand)
Length: 420
Type: CDS
Source: GLEAN
Position: GCSC_167:1401587..1401659 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_167:1401728..1401821 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_167:1401893..1404839 (+ strand)
Length: 2947
Type: CDS
Source: GLEAN
Position: GCSC_167:1404917..1405597 (+ strand)
Length: 681
Type: CDS
Source: GLEAN
Position: GCSC_167:1406230..1406417 (+ strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_167:1406517..1406964 (+ strand)
Length: 448
Type: CDS
Source: GLEAN
Position: GCSC_167:1407067..1407895 (+ strand)
Length: 829
Type: CDS
Source: GLEAN
Position: GCSC_167:1408003..1408100 (+ strand)
Length: 98
>GLEAN_379 class=GenePrediction position=GCSC_167:1400681..1408100 (+ strand)
ATGTGGATGAGGGGCAAAGACAAGAGACCCTGCTGCAATGCAACGGTCGGGCAGAAGAAGAACGAGCACCCAGCAACAGC
ACCAGCAGCAGCACTAGCACGCATGTCGGAGCCTCTCGCCGCGCGCCAAAAGAAAGCAGACCTTACCTCGTCTTTTCGTA
TGGGTCAGGTGTGGTCACGCTGCCCGTCGTGGTGTGTAGATGACCTGCTAGCCCAGCTGACCGATATTGGGCCTCTTGAC
TGGGTCGAGCTCGCCAAGGATGACAAACTGAAAAGACAGAAATACAAGTCCCGTGCTGATCCCGTCTGTGTGCACAGGAC
GCTATGCTGCAACAGATGGTGGCCGATTTCTCTGTCTCTGTCGAGAATGGCTGTCAGTGCCGGTGGCAGATTGATTGTGA
TCGAGTCTTTCGGCCACGAGGTATGTAATAGGGAAGGGATGAGGTAGATCGACGTCTTCCCAAACCGGCTAGCGCCATCT
CGTTACGTCTGCCTGAGCCACAGCGTGTTCCAAGACCGCGTCTTGGTTGGATCTTGCCAGTGGCTTTGTCGTGTCACGTG
CAATGTCAGTCTGCTACGCGTGCCTACCTGCTCCCCCGCGCTTTGCGCCTAGAGCTGTCGTCGCGTAAATTCAAACCTCA
CGATCAGAAAGTGATAAACGCGAAAGGTGCAACCTCACCACCACCAACCACCACCCTCCAACGCTTCTCGGCACCCCGGC
AGATTGCACGTCTGCACAGCCTCCATTTCACGGACGAGCGGACTTGCCTCGTCTGCTGCCCGGAAACGGCCAGCTGTAAT
ACGCGGCCTGCTTTTCGCCTCCGGCTGCGTGTTTCGTTCGTCGTCTCGCCCCGAAATCCTTCACCGCGATTCCCCTGAAA
GGCTTTGCTATCTGTCGCTGTCGTAGCGCGAACGACGGCCGCCGCCGCCGTTGCACCCTGCTGCAAAGATGGGCAAACTC
AACCGTCTGGAGCTTTTCAGTACGTCTGACAGCTTAGCTTCCGCTATCTCTTCCTTGCTTATACTAATCGGCCTGCCTAC
CGATTAGACTTCAAGTCCTACAAGGGCCACCATGTCCTTCTCTTTGGCGACTCCTACTTCACATCTGTTGTCGGGCCCAA
TGGCTCCGGCAAATCCAACTCGTGCGTCACTCCTGCTTGCTGACCCCTCGTGCCCAACGCCTCCCGTCTGACTGACCTTT
GGTGCCGTGCAGTATGGATGCCATATCCTTCGTCCTGGGTATCAAGTCGTCCCACCTCCGGTCGAGCCATCTGAAGGATC
TGGTGTACCGAGGACGTGTGATGGAGACGTCAAAGCCGAGCGAGGATGCGCCCGAGACGAACGAGACAGGCGGCGACGCT
CTCGAAGACGATGAAGGCGGCCGGTCCGGCCGTGGCGACCCCAAGACCGCCTGGGTCATGGCAGTATACGAGGACGACGC
CGGCGATACGCACCGCTGGAAGCGGTCCATCACCAACCAGGGCTCCAGCGAGTATCGCATCAACAATCGCGTCGTCACGG
CTCAGGACTACAACCAGGCCCTGGAGAATGAAAACATCCTCATCAAGGCCCGCAACTTTCTCGTCTTCCAGGGTGACGTC
GAAGCCATCGCGTCGCAGTCGTCCCAGGACCTGACCCGCCTCATCGAGCAGATCTCGGGCAGCCTGGACTTCAAGCCCGA
GTACGAGCGCCTCAAGGCCGAGGCCGAGCAAGCCATCGAAAATCAGAACTTCCACCTCACCAGGCGACGCGCCATCAATG
CCGAAATCAAACAGTACCAGGAGCAAAAGGCCGAGGCCGAGAGCTTCCAGCGGAAGCTGAACGAACGGGACGAGGCCATC
GTGAACCAGATGCTCTCCAAGATCCACCACTACCAGCGCATCATGGACGACTCCAGCGTCCAGATCCAGGACCACCAGGA
GAACCTGGCCGAGTTCCGTCGCAAGCTGCACTCGGCCGAGAAACAGCTGGAAGAGGCGCGTGCCGAATATGCCGCTGCAC
ACAAGGAGGCCTCCAAGGTCGAGAGGCGCATCCGCACCAAGGAGCGGGAGATTGAGGACGAGGAGAACAGGCTGATCCCC
AGCGCCGAAAAGGTGGAACAGCTGTCGCGCGAGATCGCCACACTCAGCCAGAGAGTGGCATCGGCTACGGAAGAGCGCGA
CGCCATGGTGGCGCGCGTGCAAAAGGCAGAAAAGGACATGGCCATTGTCGAAAAGGCCCGGGTGCAGTTTGAGAAGCAGT
GGAAGGAAACGCTGCAGAAGCAGGGCAAAGACCTGAGCGAGGCCGACCGGAAGGAATACCACACGCTCCGGTCCGATCTC
CTGAAGAAGAGCGCGCTCGAGATAGTGGACCGGGACAACATGCGGCGACAGCTCAACAGCGACGAGGTGACGGTCAACAC
GATCAAGGGCAACATTGACAACCGGCAGTCGCGGGTGGCCAAATTGGAGGCCGAGCTCGAGACGATCAGGGAGCGCCGCG
ACGGCTGCAAGCAGGACGTGCACAAGCTGGGCCAGGACGTGGACGCGGCCAAGAAGGCGTACAACCAGGCCAAGTCGGAG
CGCGTGCGCGTAAACAACACGGTGACGGAGATCGAGGAGAACATGCAGGAGATTGCCACCCGGTTGGAGACGGCACGGTC
TGGCATGGTGCAGAGCCGCAAGGAGACGCGCATGAAGGAAGTCGTGTCGCAGATGCGACGCATCTACCCGGGTGTGCACG
GTCGCGTGGGCGAGCTGTGCAAGCCAAAGCAGAAGAAGTACGACGACGCGGTGGTGACGGCGCTCGGCCAGGATTTCGAC
TCGGTGATTGTGGACGGCGAGAAGACAGCGTCGGACTGCATCCAGTACCTCAAGGAGCAGCGGCAGACACCGATGACGTT
CATCCCGCTCGACAACGTCAAGGTGAACACGCCCAACACGGCGATCCGGGGCATCCAGGGAGCGCGGCTGACAATCGACA
CGATCGACTTTGACGCCCACCTCGAGCGCGGCATGGCCTTTGCCTGCGGCGGCTCCGTCATCTGCGACTCGATGGAGGTG
GCCAGGAACATTGTGTACCAGAAGCGGCTGCCAGTCAAGGCCGTCTCGCTGGAGGGCTTCCTCATCAACCGCTCCGGCAC
GATGACGGGTGGCCGGATGCCGGACCAGAAGGGCAATCGCGGGAAGCGCTTTGCCGAGGAGGACGTGCAGAACCTGGAGC
GGATATACGAAAAGAAGCGGGCCGACCTGGAGAAGCTGCCGAAGCCGAGCCACCTGCTGCACCACGAAAAGGTGCTCAAC
GATGACCTGGCCAACCTGGAGCAGCGGCTGCGGGCAGCGCGTGCCGAGCTGCAGGCGTTTGAGAAGAACTTTGGCGGCAA
GAAGAAGGAGGCCGAGGTGGAGACGAAGCAGCTGCACGAGCGGGAGCAGAAGCTGGCAGAGGAGTCGGCCAAGCTCGAGA
GCACGCGCCGGGCCGTCGCACAGACGGAGCAGGCAGTGATGAAGATCGAGGACAAGATCTTTGCAGCCTTTTGCACGAAG
CACGGCTTCACAGACGTGCGGGAGTACGAGGCACAGCAGGGCAGCCTTGAGCAGCAGGCCGAGGAGAAGCGCGGCGAGTT
CAAAGTGCAGCTGCAGCGGCTGAAGTCGGCCCTGAGCTGGGAGACATCCAAGCGCGATAACACGGCGCTACGAGTCGAAC
AGATGGAGCGGCAGCTGCAGGTGCGGCGAAAAGACCTGCAGCAGCACGAGACGGAAAAGGCAAGTATCAGCGAGATTGTG
GCACAGGCACGGCGCGATGTGGACCATCTGCACGCTAAGTTGGATCAGATCCAGGAGGAGAACAGCACGACGACAGACAA
GGTGGCCGAGACCAAGGCAGAGGTGCAGCGGTGGCAGCGCGAGATCGAGTCGCGGCTGAAGGAGATCAACGGGCTCGAGA
CGGAGGTGCAGAAGAACAGCGCGGCCAAGTTTGCGCTGCTGCAGCGCTGCAAGATGGAGCAGATCCAGATACCACTGCTA
GAGGGCTCTCTCGACAACCTGCCGAACGAGGACCAGCTGCTCAACCAGGATCCGGACGCGATGGACGTTGATGATGGCGA
CGACGGCGTCATGGAAGCAGCCATGGACGATCACGGCATCGAGGTGAACTTTGACCGTCTCGAGGCGGAATTCAAAAATG
TTAGTGTGGCTGAGGGGCGGAAGGTTTTTGTGGTAGACAGCAGTGCCAAGTACTAACGTCTGTCTTCCGATAACAGCAGG
ACGAAGAGCACATTGAAGAGCGGCTGGAGGCCAAGATTGCCGAACTGACGGCCGAGCTGGAAAAGCTGAACCCCAATATG
CGGGCGATCGAGCGGCTAGAGTCGGTGGAAGGCAAGCTGCGCGAGGTCGACAAAGAATTCGAGGACAGCAAGAAGATTGC
GTACCGGATCAAGACGGAATTTGAGGACATCAAGGGACAGCGGACCGACGTGTTCCGCAAGGCGTTCTCGCACATCCAGG
AGCAGATCACGGAGGTGTACAAGGAGCTCACGCGGACGGAAGCGTATCCGTTGGGCGGCCAAGCCTACCTCGACATCGAG
GCCGAGGGCGACGAACCGCCGTATCTCAGCGGCGTCAAGTACCACGCGATGCCGCCGCTGAAGCGATTCCGCGACATGGA
GCACCTATCTGGTGGCGAGAAGACGATGGCGGCGCTGGCGCTCCTGTTCGCCATCCACAGCTACCAGCCATCGCCCTTCT
TCGTGCTGGACGAGGTAGACGCGGCGCTGGACAATGCCAACGTGGACAAGATCAAAAAGTACATCCGCGAGCACGCAGGA
CCGGGCATGCAGTTCATCGTCATCAGCCTCAAGCCGGGCCTGTTTCAGGACAGCGAGAGCCTGGTGGGTGTGTACCGGGA
CCAGGACGTCAACAGCTCCAAGACGTTGACGCTAGATGTGAGTATTGATTCTGATGTTTGTCTTTTTTTGCTTTGTAGTC
ATAGCTAACTTTGGGCAGCTGCGGAAATACGTCTGATTGCTATTAGGGGACACAGTGTTTGGAGTGTCAACTCGGCCGGC
GCACGTGGGCGTCATGTTCTGTGTATATACTAGGGAGGATAGCCGTTTTGTTTCTTCGGTGGGCTGTGAGTGTTGAGAGG
AGACGGCCTTTCCATGGAGTTTTAAAGATACTTGTCCTTTCGATGTGCGTCATTTTATGAAGCCCCCGGTTCTTTTCGTT
CCTTCCGCCCCATGGTGGCGTGGCCGAAGCTGTGGTTGCGCCAGTTGTCATGAATTGTGTCGTTCTTTCCCGAGTGACAA
GGTTCCGGGACTGTCTCCCTAATTATTAAAGTCCCGAAATAGCAAGTGCGGCCGTCTCAAAACGGCATTTCCCTTTTGAT
CGCGAGGGTTAGTACGCCAATGGCTGGCTTAGTATGGCAAAAGGGAGAAAAAATTTCGCTGCTACTCGTATTTTGGAAGT
CTCCACTTTTATGATTTGTGGGGGCAAAGAAGAGTCACTCTTTCTGTCGTGGGCCTTTAATGGCTGCCACATGTCCATTG
CCATTCTCTTGAGCACTTCCTTGCTTCAGAGAGCTACCCAATTCACGACCTACCTCCTGGTGCATCGCCCGTACAGTTCC
CCCCACGTCGCTCTACACAACACGGACATGTCGCGGCCAGTACTACGGAACCCGGCCACGGGCGGGTGGATCGTGCAGAA
GTTTGGTGGCACCAGCGTCGGCAAGTTCCCGGAGCAGATTGCTGAAGATATTGTCCGGTGGGTGTTTGGCGAGCAAGCTC
TACAGGTCTAGCCGAAGCTCCCACGGCAGCAGGGCCCCTCCCCCACGCCAGAGCTGACCAGACTTTTCCTCTGCAGGCAG
TATGTTTCGAGTAACAACCGGGTGGTGATTGTGTGCTCAGCACGCAGCCCTGGCAAGAAGGCCAGCGGCACGACCAGCCG
GCTGCTGGATGTGTACCGGCGGCTGCAGCAGCTGGCGGCGGCGACGGCGATCAGCGACGAGCAGGCGCAGACGGAGCTCG
TGGAGTCGGCGCAGCAAATCATCCAGGACATATGCGACGAGCACCTGGCGGCAGCAGACGCGACGATCGAGGACACAGCA
CTGCGGGCGGCTCTGCGCAGCGAGATCGAGGCGGAGTGCGGCGAGCTGGCCGAATACGTGGCGGCGACGAAGCGGTTTCA
CCTCGAGGTCAACGCGCGGTCCAAAGACCGGCTGGCGAGTCTGGGCGAGAAGCTGAGCTGCCGCTTCATGACGTACGTGT
TGCGGGACCACCAGGTGGCGGCTGAGTATGTGGACCTGGCAGATGTGCTTCACAAGAGCAGCAACAGCAGCAACAGCAGC
AGCAACGACAGCGGGCGGCTGGACGCGGCCTTTTACCGGGACGCGGCAGCGGTGTTTGGGCGGAAGATGGCAGCGTGCGA
AGACCGGGTGCCGGTGGTGACGGGCTTTTTCGGCAATGTGCCGGGCAGCCTGATGGACGGCGATGTGGGCCGCGGCTATA
CGGACCTGTGCGCGGCGCTGGTGGCGGTGGGTCTCTCGGCCAAGGAGCTGCAGGTGTGGAAGGAGGTGGACGGAATATTC
ACGGCCGACCCGAGCAAAGTGCCGACAGCACGACTGATTCCGTCGATCACGCCGTCGGAGGCGGCCGAGCTGACGTTTTA
CGGGTCGGAGGTGATTCACCACCTAACGATGGACCAGGTAATCAAGGCGACGCCGCCAATTCCGGTGCGGATCAAGAATG
TCAAGAACCCGCGCGGTGATGGAACGATTGTGCTGCCAGATCCGGTGCGAGCGCCGGGTCAACAGCTGCAGAAGTCGGCG
GCACGGGGCAGCGGAGCGGCGACGGGGCCACAGCGGCCGACGGCGGTGACGATCAAGGACCGGATCTCGGTGCTGAACAT
CTACTCGAACAAGCGGTCGCTGGCGCATGGCTTTGTAGCCCGAGTCTTTTCGGTGCTGGACCAGCACCAGATCTCGGTGG
ACCTGATCGCGACGAGCGAGGTGCATGTGTCGATGGCGATCCACGCGCCAGATGCTAGCGAGGGCGCCGCTGTTGAGGAC
AGCCACCTGGAGCGGGCGCGGCGCGAGCTGGGGGCATTGGGCGATGTCAGCCTGTTGCACGGCATGGCCATCCTCAGTCT
GGTGGGCGCCGACATGAAGAACATGATCGGCGTGGCCGGCAAGATGTTCTCGACGCTGGGCGAGCACGACATCAACATTG
AGATGATTTCACAGGGTGAGTTTGTGTGTGTGTGTTGGTGTTGCGGTTTGAAGCTGTGTGTATTGTGTTGCTTGAACTTG
TGTGTTGTTTGTTTTGTGTTCGTATGTACTGACTTCATCCAGGTGCCAGCGAAATCAACATCTCCTGCGTCATCGATGCG
CAAGAGGCAACGCGGGCCATGAACGTGTTGCATACGAATCTGTTTACGTTTTTGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62