GenePrediction:GLEAN_37 Details

Name: GLEAN_37
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:277523..280163 (+ strand)
Length: 2641
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:277523..279764 (+ strand)
Length: 2242
Type: CDS
Source: GLEAN
Position: GCSC_179:279886..280012 (+ strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_179:280067..280163 (+ strand)
Length: 97
>GLEAN_37 class=GenePrediction position=GCSC_179:277523..280163 (+ strand)
ATGGCACCATCCTTCCTCAATATCAAGCAGCTGCGGCGAAAATCTAGGGCCAGCTTCCGGACCGAGAAGTCGAACGACAC
GTCGAGTGAGGGCAGCCACAGTAACGGCACGGCCCCGACCAGCGGTTCGCTCACGCCGCCGTCCATCGCCCAGCAGTCCG
ATCCGGCACTTCACCTGCAGACTCGTGGCCGCAGCTCGCCCCCGCCGCCGGTTCCCCGCCGTCCGCCTCTGACGTCCTCG
GGCACGTCGACGTCGATGAGCACGGCGGCCGGCGGCAACTTCTCGACCAAGCGCTACAGCGTCTCTGGTATGGCCGGGCT
CGGAGCGCCCCTGGTCAACGGCAGCAATAGCCGGCTGCTCTCGTTGCCCATCTCGCCATACTCACCGCGCATCGACAGCA
TCCAGGACAACTCGTGGGTCTACCAGAAGGTGCTGCTGGTCCACGGCATGGTTGGCGACCCGGCCGCCAAGACGCCGGTT
GACGGCACCGTGACGGTCAGCCGGCTTGACGACGGCTTCCCGGCCGTGCAGTGGCCGGTGTACAGCGGACACTTCAAGGC
GCTGGTGTACCTACTGCCCGGCCCCAATAAAATCCGGTTCGACTTTGCGAGCCCGAAGCTGGCCAATAGCGGCACCTCGA
ACCCGATCCACGCATCTTACTTCACGCTGCACATGATGCCGCCCATGGGCGCGCCGCCGGTCCACCTGGCCATTCTGCTG
GCCAAGGACTCGCCGGGCACGTTTGACGCGATGCCGACGCGGGCGGAGCGCGAGGGCAACGGGCTCGAGACGGCGGTGCG
CAAGTTCCGCATGGCGGCCTACCTGTGGCAGGCGTTCACGGCCGAGCAGATGTGGCGCAACCGACTGGGCAGACGGGTGT
TCCGATACGAGGAGGAGTGGACACAAGGCTCAGCCAACTATCGGGACCGCGAGACAGGACAGATGCGATCGGAAGCGCGG
ATTCATGTGGTGCGGTCGAACAAGACGGTGGCCGAGCTGCGCGATCTCAATCGGGCGCAGCAGAACGACAAGGGCACGGA
GCGGGGCGCGCTGTTCGACATTGCGGCGGAGGCGATGCGCGAACACTTCCAGCCCAAAGCGGGCCAGACACTGTATGTAT
CGGTGCTGCTGCTCGACGCGCACTGGGACACGACGGCGAAGACGATCACGGGCCACGCGGCGCTAGGCGGCTCGGCCGGC
GACGTGCGGCTGGCCGTGTTCGGATCACACTGCCTGCAAAGCTATCCGAGCAGCTTCGAGGAGGTGGTCCCGGCCTTTCT
GGACTGCACGCCGACCGATACGGCCTTTGTGGCCAACGACTGCAACGAGGCAGGCAGCTCGTGGGAGGCGGCCAACATTG
GCATCGGCGGCCACCTGCACGAGACGGGCCATCTGCTGGGGCTGCCGCACCGGGAAAACGGTGTGATGCTGCGCGACTAT
GTGCGTCTGAACCGCAGCTTTGTGACGCACGAAGCGTACTCGACGCGCACGCGGACCAAAGGCGGCGGGCTAATGCTGGA
GGCGGACGAGTGTACGTGGCACCGGCTGGACTGCCTGCACTTTCGCAGTCACCCGTGCTTCCGGCTGCCGAGCGACCTGC
CGGCAGGCGTTGACGAGAGCGTGCACGCCTGGCCGGTCGATGGGGGTAACGTGCTCCTGACGGCACCCTCGGGCGTGGCG
TATGTGGAGGTGTATGCCGAAGGCGACGACGTGTGCCACACCTGGATCGAGTATCCGACGGGGGAGTATGGCAGCGGCAG
TCCCGGGACAAGCAGCAGCAACATTGCCGGTGGCGGTGGTGGCGGCAGCTCGAGCTCGCTGAGCCGGCAGGTCACGCTGG
CAGACCAGGATGTGCGCAGCCGGCTGCCGGAAGCAAAGCGACGCAAAGACGGGCCGTTGCGTGTGGTGGTGCACTCGTGG
GCAGGCGGCAGCCTCAACGTGGCGGACCTGCGGCAGCTGACACGCGGGGCGGCGACGAAGCTGAGCAGCGGTAGCAGCAG
CGTCATGTCGCTCAAGGGCCGGACGGCCTTCCGTAGCAGCGCGCTCGGGCTGTCGCAGACGGAGGGCAGCACGCCACAGG
AGCTCGTCTTTTCGAGCGCCGAGCGGCAGGAACGGGTGATGACGCGCATCATCGTGTACCACGGACTGTATGTGGACGGC
ATGGAGTTTGTGTACGATGACGACTCGCGGCAACTGTTTGGGAAGCGCGGTGGGAAGCCGGGCGGCGACATGTTTGAAAT
GGGTGAGTTTTTTGTCTTTTTTCTTCTCTTTTTTCTTCTCTTTTCTCTCTTTTTTCTTCTCTTTCTCTTCTCTTTTTCTC
TTTCTTCTCACCTCTCTCTTCTCATCTCGCCTAACAAAAAAAGACGTCCGTCGCGGCGAGTATATTAGTGGCTTCAGCGT
CCGGTCCGGCTTCTGGGTCGACGGCATCCAGATCCTCACCAGCCTGGGTCGGCGATCACCCGTCTACGGCAACGCCCAGG
GCGGTTCCGCGTACGTTGCTCCCTTTCTCCCCGAGCTGCCGTGCCCACAATCTAACCATCACAGCAACACGCTCATACCA
CCTCGTGGATATACCATCTGCGGCGTGGCTGGGTCCTCTGGCACCTGGGTGGACGGCTTCTCCGTCCTTATTACGAAATG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62