GenePrediction:GLEAN_3804 Details

Name: GLEAN_3804
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:981180..982307 (+ strand)
Length: 1128
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:981180..981450 (+ strand)
Length: 271
Type: CDS
Source: GLEAN
Position: GCSC_113:981489..981571 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_113:981645..982307 (+ strand)
Length: 663
>GLEAN_3804 class=GenePrediction position=GCSC_113:981180..982307 (+ strand)
ATGGTGTTGCACAACCCTAACAACTGGCACTGGGTGAACAAGGACGTGTCGGCGTGGGCGACTGAATGGTTTGAGCAGAA
CCTGACGAAGCTGCACGCGGAGGAGGGGGATACAAAGGCCAGAATATCCAAGGTGGTCAGCTCCACGGGCGACGTGGACG
TGAGTCAGAGGAAGGGAAAGGTTATCACGATCTATGACGTGAAATTAGTGCTGGAATACACAGGTAATGACACGATGCCT
CTCGAAGAAAATGTCCCCAGCATTGCCAAAGGTCTGCCGGAGACTAACGTGTCCTGTTTCTTCCTACAGGGTCCACTGCG
GAAGAAGATGACGTAAGCGGGTCGATAACGATCCCGGAGGTGGCCCACGACACGGAAGAGGATGAGTTCGTGGTATGTCT
GCTTGGGAGAGCGAGGACGAGACGTCGGGGGATATGGTCGAGCTAACGTAAGATGTGACGCCCAGTTCGAGATTGACATC
TACTCGGACAGCAAAGGGAAGCAACCGGTGAAGGAGCTGGTGCGGACGCAGCTGTTCCCGCAGCTGCGCAAGGAGTTCCT
AAAGCTGCCGGCAGCGCTGATCGCGGAACACGGGGCGGGCATCCAGCACGCCCCTGGCGAAGACCCTTCGACCAAATTCC
CGCCGATGAAGTATCTTCCCAACACGACAGCGGCGAAGCGCGCAGAGACGACTAAGCAGACCGAGGCTAGCTCGGAGGTG
CACGTGGTTAACACGACGACGGTGACGGATTCAGAAGAGTTCCGGACGACGGCGGCAGAGCTGTACCAGACGTTTACGGA
TCCGCAGCGGATTGCGGCGTTCACACGGGCGGCGCCGCGGCTGTTTGAGGGCGCCAAGAAGGGCGGCAAGTTTCAGCTGT
TTGACGGCAACGTGGACGGCGAATACCTGGAGCTGACGGAGCCGACGCACATTGTGCAGAGCTGGCGGCTAAAGCAGTGG
CCGACGGGCCACTACTCGAAGCTGCAAATCGACTTTGACCAGAACGACGTCGACAGCGTAACAGTGATGCGTGTCGAATG
GACGGGCGTGCCAATTGGCCAGGAGGAGGTGACGCGGCGCAACTGGAGCGAGTATTACGTGCGCAGCATCAAGCTGACAT
TTGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62