GenePrediction:GLEAN_3805 Details

Name: GLEAN_3805
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:994451..996515 (+ strand)
Length: 2065
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:994451..994506 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_113:994630..994707 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_113:994769..996515 (+ strand)
Length: 1747
>GLEAN_3805 class=GenePrediction position=GCSC_113:994451..996515 (+ strand)
ATGGACCCAAGCAGCAGAAAACGAGGCTATGTCAACTACCCTGAACCGCTCAAGGGGTAGGTGTTGGCATTTCCACAGCC
ATGGCTGCCCAGCCGTTCCAGACGGCCATCGCCGTGTGTCGCAACGACCCCGTTGGACTGCCGGTGAAGAAAGAGCCATG
CTAACATGATTGTCGTCAGGCCTGATGTACCTTACCAAGATGATCGCAAGTCGAACCCCGCCATCCGGGGCTGGATTCTG
GTCATTTGTGCCTACATGTGAGCATCCCACTGGGACCTGGAGAGCCATAGCTCACAGAGGCTGACTACTGGACAACAGAA
TGGAATATGTAGGATTTATTCGCCGTACGGTCTGGAAGAATGCCGGCTTCGCCACACTGCGCAATATTCGGCCGCAGATT
GAGGACTACGAGCCATTCTTTGAGCCGGCCATTGTCCCGCTACCAGATGCTGTCGAGCCGACCGACAAGCCGCTAGATTT
GACACTGCCAAGCTCTCTACCACCACCACCGGCTGAAAGGTACCCCGCGTCGAGGTACTATTCGTCAAATGATTACCACG
AGCTCTACCTCTCCGGGAAGTTGACCCCAACTGCTGTGGCAGAAGCTCTGCTGCCTCTGATCCGACGGAACCAAGGCCAG
AAGGGCCCGTACTCAATTGGCTGGTTTGACACAAAGGAAGATCTGGTTTTGCGGGCTGCGGAAGCATCGACTCTGCGGTA
TCGCAAGAAGCAGTCTCTTGGTCCTCTGGATGGCGTCCCGACGGCCGTCAAAGATGAGTATGACATGGAAGGGTACATGT
CATGTCTCGGCTCTGTGAACGACTACACTGGCAGCTTCCTCGAAGACGGCACCTACACGACATGGTGCGTGCGCAAGCTG
GAGGAGGCGGGCTGCATCATCCTGGGCAAGCTGCACATGGTCGAGTTTGGCCTTGACACTCCTGGAAATAACATCAACCA
CGGAACTCCACCAAACCCTTACAACGAGAGGTACTACACGGGCGGTAGCTCGTCAGGTGCCGGTTACGCTGTTGCCTCGG
GCCTCATTCCCTTCGCGCTGGGCAGCGACGGTGGCGGCAGCGTGCGGATCCCGGCCTCCTTTTGCTCTGTGTACGGACTG
AAGCCAACACACGGACGGATCTCTTTCAAGCCAGGACAGAACCACTGCATCACCTGCGCGTGCCTCGGTCCGCTGGCAGC
TGATGTGCGCACACTCGCTACGGCTTACTCCGTCATTGGCCAGCCGCATCCGACGTCCGCCTTCCCACCTGTGCCTCCGC
CATCCGTATTGCTTGACCGTCAGCGCCCAACTCTTCCGTCCTCCCTCTCGGCACCGTCTTCTCCGCGTGTTCTTGGCATC
CCGAACGTGTGGATTGCGCAGGCTGTGCCGGCTGTCCAGGAGCTGTGCAACACATTTATTGAGTCTCTGGTTCGCGATCA
CGGCTACACTACAGTGCCCATCGAGATACCCCTCTTGGTTGAGGGCCAAAATGCCCACGCCTTGACCGTACTCACGGATG
CGGCCACTCTTCTCCCGGAGTATGGAAACCTCACGCCGACAACGCGCATTCTGCTTTCATTGGGCCGAACAACGCCGGCG
ACAGACTACCTGCTGGCCCAGAAGCTCCGTCGCGCGCTTGTCCAGCATTTGTCCTATCTGTGGCACAAGCATCCCGGCAT
GATTATCATGACGCCAACAACGAGCTGTGCAGGCTGGCCGGTGCGCAGTCCCAGTGAATACAGTTACGGAGTAAGCGATG
GTGACACCACAATTCGCAGCATGGAGTATGTTTGGCTGGCAAACTTCTGCGGTCTCCCATCAATCAGCATTCCAGCTGGT
TATGTCGTGCCGGAAGGGCAGCCGGGTGCCGGAAACATTGCAGGCGCCAACGTCAGTGGGAAAGTGCCAGTTGGCATCAT
GGCCACGGGTGAATGGGCGACAGAGGCTGACTTGCTCCGCTTTGGCATGGATGCCGAGTCCGTTTCGGCTGAGCGCCGCG
CGCGGCCGTCTATCTGGTACGATGTTGTGGCATCGGCTAAGCCCAAGAGTGCTATCACAATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62