GenePrediction:GLEAN_3806 Details

Name: GLEAN_3806
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:999798..1001709 (+ strand)
Length: 1912
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:999798..1000233 (+ strand)
Length: 436
Type: CDS
Source: GLEAN
Position: GCSC_113:1000301..1000395 (+ strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_113:1000457..1001373 (+ strand)
Length: 917
Type: CDS
Source: GLEAN
Position: GCSC_113:1001451..1001709 (+ strand)
Length: 259
>GLEAN_3806 class=GenePrediction position=GCSC_113:999798..1001709 (+ strand)
ATGACTCTCGACGGGAAAATGCAAGCAAAACGACCTTCCGATACTGAAACCGACGATGAGGTGCCCTTGGAACGTCAGCG
CAGCGTCGAGCAGGCCGCCGATGAGGGTCACGACGCCGACATCCCATCCAGCATCGGCTACGTCTTGGACGAGCGTGGGG
AGGAGAAGCTGCGCAAGTCCCTTGCTGAGCAGAGACGCAACTCTCTGGCACGCCGCACCAGCCATGGCACAGAAGACCGT
GCCGTCGCTGACGTGGAGAAGGGCAATGCCAACGATGGCGCAAAGGGTGATGCTGATGCGCCCGAAGACGAGGCCAACGT
CGTTTGGTGGGATGGACCTGACGACCCCGAAAACCCATATAACTGGCCGACCTGGTACAAGAGTCTACTGTGCGGACTGA
TCAGTGCGGTGACGTTTGTCACGCCGCTGGCATCCTGTAAGAAAATTGCCGTAATCCCTTTTTGATACGCCGGTCAGAAC
ACTGACTGTCCAAATCTATTCAGCCATCTTTGCGCCTGGCGTGCCCGAGCTCATGGCGGAATTCCACGAGGACAGCACCT
TATTGGCTTCCTTTGTCGTGTCCGTCTACATTTTGGGTGTATGTTTAGAGGCCCTCTCTACATTCTCTGTTTCCTCTGCC
CAGCTTACATATTTTACAGTTTGCCTTTGGCCCTCTGCTGATCGCCCCTCTGTCCGAGATCTATGGCCGCAACATTGTTT
ACCACGTATGCAACGTTGGCTTCATTGCTTTTGTCGTTGGCTGTGCCCGGGCACCTACGCTCGACGCGCTCATCGTCTTC
CGTTTCTTCAGCGGCATCTTTGGCTCATGCCCCATCACCAACGGGGGCGGCTCCATCGCCGACATGGTTGCCCAGGAAAA
ACGTGGTCTTGCCATGGCCTTTTTCTCTGTTGGTCCGCTGATGGGTCCGATCATAGGTCCTGTTGCCGGTGGTTTCCTGG
CCAGTGCTAAGGGCTGGCGCTGGGTCTTCTGGCTGATTGTGATCATCGCCGGCTTCCTCAGCCTTGTCTCCGTTTCTATC
ATGCGTGAGACCTACGCTCCCATCCTGTTGCAGCGCAAGGTAGCGCGCCTGCGCCGCGAGACTGGAAACGATTTGTTGCG
TAGCCGTCTGGATATCGGCCTCAGTACCAGGGACTATTTCACCCGTGGCATAGGTCGGCCCATCAAAATGCTGACCTTTT
CACCCGTCGTGCAGGTTTGCGCCATCTACATGGCCATCGTCTACGGCTATCTGTATCTCATGTTTACATCAATCACCCAA
GTATTCGAGGAGACATACGGCTTCTCCACCAACATGGTCGGCCTTGTCTATCTGGGACTCGGCGTTGGCTCTATGGGCGG
CATGATCTACTTCAGCGCCATCTCTGACCGTTACATCAAAAGCCAGTCCCTTAAGGAAGGCCAGGGCATGAAACCCGAGT
ATCGTCTGAAGCCGCTTCCTGTGGGTGCTATCTTGCTTCCCATTGGCTTCTTCATCTACGGCTGGACGGCCGAGTACCAC
AAGCACTGGATCGCGCCTATCATTGGAATGGTTGTCATTGGCTTTGGAAACCTGGTGTATGTTCTTCCTTCTTCCTTTGT
CCACTTGCTTCTGTCTGCTGTATCTTGTGCTGACTAGCATTTCTTTCTTCCAGTATCTTTATGGCCCTACAGCTGTATCT
GGTAGATGCCTTCAACATCTATGCTGCATCTGCGCTGGCAGCAAACACCGTTGCCCGGTCTTTTGTCGGTGGCGTGCTAC
CACTTGCCGGTCTAAGTATGTACGCTAAACTTGGCCTTGGTTGGGGCAATAGCTTACTGGCCTTCATCGCGCTGGCCCTG
GTCCCGATACCCTTTTTGATCATAAAACACGGCGAGTATCTGAGGAAGAGGTTTGAGTTGAAGAATCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62