GenePrediction:GLEAN_3807 Details

Name: GLEAN_3807
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1003125..1004254 (+ strand)
Length: 1130
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1003125..1003307 (+ strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_113:1003364..1004254 (+ strand)
Length: 891
>GLEAN_3807 class=GenePrediction position=GCSC_113:1003125..1004254 (+ strand)
ATGTCTTCCAAGATTCTCTTTCTCTCTGCTCTTGTAGCCTTTGTCGAAGCCCGGTTTGGCCAGGAGCAGGTTCCTGTTGC
CGCCATATCGGCCCTCACCAACCGCGGCAAAGCTGGCGATGCTGGAACGCTCTCCGGACAGGTTCCGGGCGTCCTCCTAG
CTGGTGCCAATGCCTGTGCAAAGGTAAACTCATTTTTGTCTCACCATGGCTGCTGATAAGAGCTGACTCCTGATTGCAGC
TCACACTTGCCGACAATATCGTTTCCACGCTTGGAAGTACTTCTGACGTCTTATCCGCTGCTGCCGGACTCGTTGCTGCC
GAGAAAAATTTCAATCCTTTTGTCGTGTCTGTGCCTTCGTTGTGCTCAGATCCCACCCTGCCGACCACAGCTGCTCTGCG
TGGCATTGTGCCTTTGGTGGACCCATCAGTTGGCGGTGCTGATACCGAGAACGCAAAGTCGAAAACGTCGCTGACGACGC
CGTTTAGTGCTGATGGCAAAAGTGTCGCCGATGTTGCTTCTGCCAACGGCTTCACAAACTTTACTTCCCAGGGCACCGAC
GGTTCGACGTCCAGTGCATCCTCAGCAACTGCCCCATCGAACGTGGGCAGCAGCGGATCATCCTCATCGTCGACGGCTGC
ATCTGCGGCCACCAATTCATCATCTTCTGCAACGGCTTCTTCGGCGTCTTCGTCTTCGACATCTATCTCCTCTTCTGTTG
CATCTTCCAATTCCAGCAGCACTGGAGCTACCGTAAACGGCGTCCAGCAATCGTCAATCTCCGGACTGGACTTTGGCCTC
TGCGTTCCGACAATGAAGTTCGAGGCAGGTCTCAATGGCCGTAAAGATACCGAATCTACCTTCCAGGCGATCGACTCGCT
CGTCAACAAGGGCCAGCAGGAGGCTCTGAACCCCAACATTATTACGAACCGGATTTGTGACCAGCTGACCAACGTGTGCA
ATGCCAACCAGGCTGCCAAAGATGCGTGCGCGGCTGCGAAGACGAAAATCTCGTCGCTTGGTACCAAGGATGTGACCACA
GCCGATGCCTGGAATACGGCATTGGGATTTGCCGGAACCAACACCAACCCAGATAACGCGCCTCAGACTGGATTGGTGGG
CCACTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62