GenePrediction:GLEAN_3808 Details

Name: GLEAN_3808
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1006943..1008466 (+ strand)
Length: 1524
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1006943..1007217 (+ strand)
Length: 275
Type: CDS
Source: GLEAN
Position: GCSC_113:1007290..1007995 (+ strand)
Length: 706
Type: CDS
Source: GLEAN
Position: GCSC_113:1008059..1008466 (+ strand)
Length: 408
>GLEAN_3808 class=GenePrediction position=GCSC_113:1006943..1008466 (+ strand)
ATGTCTTATGAGGCCGACGAACATGAGGCCGAGCATGACACTGACGATTTTGACACCGACGATCACGATACTCACGATAC
TGACGAGCATGAGACTGACGAGCATGAAACTGACGAGCACAAACTTGACGAGCCGTTGCAACGCAAACAGAGCGCGTTAA
ATCGTATCGCAAAAATGTCAGCGTTTTTGCTGTTCGCCGTTTTGGCCACCGCTTTGCTCTTTGTCAGTGCTAAGCAGGAG
CAAGAACCTATGCGCAACCTTGTATACTGGACCGGGTAGGATATGTGCTGTCCTAGGACCCTTTTTCTGTCGGCCAGACG
CTGACGCGCCGGCATCGATCTTCACAGGCAGCACCAGGACGTGCCCTCTGGACTTCCGGAGATGGATTATGTCTCGCACG
TGGCTCTGGCCTTTATGCAGTCAAGCCTGTTCAACGAGTTCGACGGCGTGAAGCGTACGGAGTGGCCGCTCTTCACCACT
GTAGGCCAGGCCCGCGCACGCTTTGCTCCAGGCACCAAAGTCCTCGTCGCCATCGGCGGGTGGGGCGAAACGGCTGCATT
TTCTATCGCAGCACGGTCCGAGCAGTCACGAAAGCGGTTTGCGCGCAACGTTGCCGCCATGGTAACAGCCACTGACGCTG
ACGGAGTGGACATTGACTGGGAGTATCCAGGAGGCAATGGCGAGGACTACAAACAGATCACAAATGACGAGAAGGCGTGG
GAGATCTATGCATATCCGCTCCTCCTGGCCGAGATCCGGTCAGCCCTGGGCCGGGACAAGATCATCTCGGCAGCGGTCCC
GGGAAAGCCAGAAGACATGCTCGCATTCACGCGCCTGACAGTACCTCGCATTATGAACAGCGTCGACTTTCTCAATGTCA
TGACGTACGACCTGATGAACCGGCGCAACACCGTGACCACGCACCATGCGGGCGTCGAAAATAGTTTGGCGGCCATTGAT
GCCTACATTGCGGCCGGTGCTTCACCTCAGCGGCTAAATCTGGGGTTTGCCTACTATGTGAAATACTTCAAGACCGAGCA
CGATGATTGCCAGGTAAGCGATTCCCGAACTCACCCGCCTATATGTAACAGAATTTGATGTGCTGAAAAATGATAGGAAA
TGGTAAACCAAGGGAAGGCACCGATCGGCTGCCGAACTCTGTTGATGGAAGATCCAGGAACTGGCAAGGACATGGGCCGG
GCTGGTGCGTTTTCGTGGGACGATGCTGTTCCGTCGAGAGTGAAGAGCTCTTATAACCGGGCGATGAAGGAAGGAGTGTA
CGACGAGGTGCACGGCGGTCATTACTACTGGGATAGTAAGGAAGACCTCTGGTGGACATTTGAGACGCCTCTGTCGATTG
CCACAAAAAAGTTTCCGCTCGTCGTAATGAACAGGCGACTGGGTGGCGTTTTTGCGTGGGGCGTGGGCGAAGATGCCCCG
TTGTACCGGCATTTCAAGACGTTGAGCCATGTGATGGAGTTGATCAGAAGCGGCGAGGGGAAAGCTTTGTCGGACGAGCT
ATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62