GenePrediction:GLEAN_3809 Details

Name: GLEAN_3809
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1013666..1015467 (+ strand)
Length: 1802
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1013666..1013798 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_113:1013867..1014706 (+ strand)
Length: 840
Type: CDS
Source: GLEAN
Position: GCSC_113:1014779..1015467 (+ strand)
Length: 689
>GLEAN_3809 class=GenePrediction position=GCSC_113:1013666..1015467 (+ strand)
ATGCAGACGCAGACCTTTTACTTTTTGGGCGAGCCCGGTGCCTCGGCCAAGGCCATCGACCTGGAGCCCGACCTGTCCTT
TGACCAGCTGCAGGCCCTCGTCGGCGCCCATTTTGCCGTGGTCAAGCCGTCTGGTAAGAGCGTATCTGTCTCGTCCCCTA
TCGCATCCGTTCGTTCTCCGGTCTGACAGACGGCCCCCTAGGCATCGCCTTCCAGAGCGGCGACGATGCGCTGAACGAGG
TGGCCGAGATCCTCGCGGCCGCCGAGCCGGTGGCCCTCACAGTCGATGGACACGCAGTGCGAGACGTGCCCAGTCCACCG
GGCGGTCTTCCCTACGTGGGCAACTACCTGCAGATCTACCCAGACCACCTGGGCAACCACCAACGGCTGTTCGAGAGCCT
CGGGCCCGTCATTAAGACGGTCTCGCTCGGCCGCACCGTCTACCAGACCAATGACCCCGAGCTTGCCCTGGTTGCCTTTG
CTGAGGACGCCTTCTTCACCAAGCACATCAACGAGGCCCATCCGCTCTTCCCCATCAAGACGCCTGAGGCTGGCGTCTTC
CTCGGCGACACCGACACGGCCGAGTGGCGGCTCGTCCACAAGTTCCTGCCGCCAGCTCTAGGACCCAAGGCTGTGCGCCA
CTACGCGCCCACGATGCAGCAGACGATCGAGTCGGCCTTTGCCGTCTTCGACGCCCTCGACACCCAAGACACTGCCTGGA
ACGTGTACCCCTACATGGTCAAGCTCGGCTCCCAGGCCGTCGGCAAGATCACCCTCGGTATCGACTTTGGGCACTTTGCC
GGCCCTGACGCCCCCATGCACGAGATGGTCAGCCTGATCGCCGAGCTGCTCTCGCTCAACAAGAAGGTCATGTCGCGCGG
CGACTGGTACCGCAGTCTTCCCTTTGGCGACCCGGCGCGACTGCGTGCCGTCCGCGCCCGTATCGAGGCCATCTTCGACG
AGTCTGTCCGCAGCGCCACTGCCGCCGGCGTCGAGGACCTGCCGCTGCAGACGGCTGCCCTGCAGGCCGCCAACATGGTC
GGTACGTCTCGTCTGGTGACACTAAACGCTCCTCGAGTCTGTGAGTCTGTAAGTCCACGCTGACAACCCCTAGACTATGC
TGTCCGCGCGGTCGACAGCAAAGGCGAGAAGCTGCCGTCTGCGAACCTCCTCTCGGCCCTCATCGTCGTGACTGGCGCCG
GCTTCACTACCACCAGCTCGCTGCTCTCGTGGCTGATCTACTCGCTCGTCACCTATCCCGGCGTCCAGGACCGCCTGCTG
CAGGAGCTCGTCGACCACGGCTTCGACGATGAGACCGTCCTCACTGCTGACTTCACCGACGGCCTGCCCTTCCTCGACAA
CTTTGTCAAGGAGACCCTGCGCCGCCACAATCCCTCTTATCAGCCCGGCCGCACGGCCAAGGCCGATCTCGTCCTCCCCG
GTGGCTATCGTCTGCCGCGCGATACCATCCTCATTCCGGCCCTGCACCACATCCACAACAACCCGGCCGTGTGGGACAAC
CCGACGCGCTACGACCCTGACCGCTGGGACACACCGGCCGCCAAGGCCGTCCCCAAGGGGGCCTTCATGCCCTTTGCTGC
CGGCCCGCGCATGTGCATCGGCTTCCACTTTGCCCTGCAGGAGGTCAAGGTCTTTCTTCCCAAGCTGGTCTATCGCTACG
AGTTTATCCGCGAGGGTGACGGGACCATCGAGTACGACCCCATGTTTCAGCTGATCCGGCCCAACAATCTTTATGTGCGG
GCGAGTCGACGTGTCAAGTGGCCCCTGAAGACGACGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62