GenePrediction:GLEAN_380 Details

Name: GLEAN_380
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1417060..1417363 (+ strand)
Length: 304
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1417060..1417171 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_167:1417254..1417363 (+ strand)
Length: 110
>GLEAN_380 class=GenePrediction position=GCSC_167:1417060..1417363 (+ strand)
ATGGCGGTCTCTGCGGCCTCTGTGACCGCTACGACCGCTACGACCGATCCCACTATAACGGGCCTTTTCCTTATCACCAC
GCCGAAGACCAGGGGTCCATTGGCCAAACATCGTCCGTCCTCATATCGTCGTCTTGGTCTCGCCCTCTAAATTATCCAGA
AAGGCACCCATGAACCTTGAATACTATATACTAGGACACCTGCTGGCGCGCTACGAGCACACCTTGTTCTCAGGCCGTAC
TCCGTACCGCCCCAAAACCAGCTACGTCAACGGCCTCAACCCCAATTCGAACTCGCAATCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62