GenePrediction:GLEAN_3810 Details

Name: GLEAN_3810
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1017084..1019074 (+ strand)
Length: 1991
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1017084..1017493 (+ strand)
Length: 410
Type: CDS
Source: GLEAN
Position: GCSC_113:1017573..1017712 (+ strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_113:1017773..1017946 (+ strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_113:1018098..1019074 (+ strand)
Length: 977
>GLEAN_3810 class=GenePrediction position=GCSC_113:1017084..1019074 (+ strand)
ATGGATGAGGACCAGATTCCGGCACAGATCGTGCCATCAAGGCGGCGGAAGACAATGGGCGACTACCTGCACTCGCTCAA
GGATTTGTTTTTCACGCGCAAAGGCCTCCTCGGCGATTACGACTACGGCTTTCTCTTTAGGCCCAACCTGCCGTTCATGA
AGGCACCCCGGCTGTCGTCGCCCTTTTTTGGCCTCAACGACTCTATGCCTGTTGCGCTGGCGCTGCTGCTCGGCTTCCAA
CACTCCCTGTCTATGCTGGCTGGCATCATCAGCCCCCCGCTTATCATGGCTGGTGCTGGAGGCGCCAACCTGACCCAGTC
ACAAGAGCAGTACCTCGTGTCAACCGCTCTGATCGTCTCCGGCATCCTTTCCATGATCCAGATCACTCGCTTCCACATCT
ACAAGACACCGTATGCGGCTGCCTTCTTCCCTCCCCCCCATGCTATGGCCAAGCTGTCTGGGCTGCACAAACGGCTGACA
TCAGTGTAGGTACTTCCTCGGAACTGGCCTCATCTCTGTCGTCGGAATCTCATTTGCCATCATCCCCGTCGCCTCGGGCG
CCTTCAAGCAGATGTACGCCAACGGCTTCTGCCCGACCGCTGAAGATGGAACACTGCTACCGTGTCCTGGTGAGTGTGTA
TATACTGCCCTTTGTTCTGCTTTCTCTTCTGCGTGATCTAACTTTCCAGATGGCTACGGAGCTCTGCTCGGCACAGCTGC
AGTCTGTGCGCTGCTCGAAATTCTTATCTCCTTCATTCCTCCTCGGACAATGCTGAAGATCTTCCCGCCCATCGTCACCG
GCCCCACGGTCATGCTTATTGGCATCTCGCTCATCCAGTCTGCCTTTGAGGATTGGGCTGGCGGTTCCGGATCTTGCAGC
GCCACTGACCCGTCTGCATTCTACGCCCTTTGCCCCAATATCGATGCACCCCACCCGCTTCCATGGGGCAGCGCGGAGTT
TATGGGCAAGTCTTCTGTTCATAACTCTATATCGCTTGTAGCTGACACATGCAGGTCTCGGCTTCTCCGTGTTCATCGCC
ATCATTCTCTGTGAGCGGTTTGGTGCGCCCATCATGAAGTCGACATCCGTCGTGATCGGCCTGCTGGTCGGCTGCATTAT
CGCCGGCGCATGCGGATATTTTGACAAGTCGACGATCGATGCAGCCCCGGCAGCTTCGTTCATCTGGGTGCACACGTTTA
AGCTGAGGGTCTATGCGCCCCTAGTACTGCCGATGCTGTCGGTCTTCGTCATCTGTGCATGCGAGGCCATTGGCGACGTG
ACCGCGTCCTGCGATGTCAGTCGGCTGGAGGTCTCGGGCCCGATCTACGAGAGCCGGATCCAGGGCGGCGTCCTCGCCGA
CGGCTGCAACGGCGTGCTGGCCGCCCTGATGACCATCACGCCCATGACGACGTTTGCCCAAAACAATGGTGTCATCGCGC
TGACGCGATGTGCCAACCGCAAGGCTGGCTACTGCTGCTGCATCTTCCTCATCATCATGGGCGTCTTTTCCAAGTTTGCC
GCTGCCTTGGTGGCCATCCAGAGTCCTGTTCTCGGCGGCATGACCACCTTCCTCTTCTGCTCCGTCGCCGTGTCTGGAAT
CGCCATCATCACGCGTGGCGTGCCATTCAATCGCCGCAACCGCTTCATCCTGACTGCCGGCCTGGCTCTCGGTTACGGCG
CCACCCTTGTGCCTACCTATTTCTCCTATGTCTTCACCTACAAGGGCAGCAACAAGTCGCTGTCCTCCTTCCTCGACGCC
ATCGTCCTCGTCATGGAGACTGGATTCGCCGTCACTGCCGCAGTCTGCTGCATGCTCAACCTGTCACTGCCCGCGGAGAT
CGACAATATTGACGAGAGCGAGATTCCTGCCGACTTTCCCGAGCCCGACGAGGCACCACCCACTCGTGGCGAGCTGGCCA
GAAAAGAGGAAACTGATCGTGTCGGTGCTGGGAGCGATGTAACGGCACCGCGGACGTTTCTTGAGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62