GenePrediction:GLEAN_3811 Details

Name: GLEAN_3811
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1023480..1026301 (+ strand)
Length: 2822
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1023480..1023611 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_113:1023666..1023824 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_113:1023882..1024015 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_113:1024075..1024143 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_113:1024201..1026301 (+ strand)
Length: 2101
>GLEAN_3811 class=GenePrediction position=GCSC_113:1023480..1026301 (+ strand)
ATGCGTCTCTCAGCCATAGCAGCCAGCCTGGGGGCTCCGGCCATTGCGGCTGCCACAGCCAACTACTCACTCTCGGACAC
TAACAAGGGGATCGCACCGGGTGCTTATATTGTGGAGTTTACTCCGGAACATGTGCGTTTCCGGTGGCAAGAATGACGGA
CGACGAACGGCACTAACGGGCAGCAGACGTCTGTCGACAGCTTCTACCAGAACCTGTCGTCGAACGGGATCCACGCGGTC
CAGCGCCGAGCGTTCGATCATGCCTTTTTCTCTGGCACTTCGTTCCACCTGCCGGCGAACCGGACATCCGACCTGGACGT
TATTGGCAACTTTACGCAAGTCAAGGTTTGTGTCTGCACATGCACCACTTACAAGCAGTGCGACGTCTAACAGTCATCCC
AGGCCATCTCTCCGGTCCGTCTGTTCTCGCATGGCTCGCCGATCTCGCGGGACAAGCGCTTGAGCAAGGTGGAGGCGCTC
GCACGGAGCAACAAGAAGCGTGCGCTCCAGGGGGCTCCCTCGTCTCACGTCATGGCGTAAGTTCTTTGCCAGGGAAGGTG
ACGACGGTGAACATTCAGCTAACAGTCACGACTAGCGGCGTGGACAAGCTGCACGCAGAGGGCATAGATGGCAGCGGGAT
CATGATTGCTGAGATCGACACAGGGTAAGTCTTTGTCTTTCCGTCTTTCTGTTGATCCTTTCTGGCTGACATGGACTGCA
GAATCGACTACACGCTCCCGGCTCTGGGCGGCTGCTTCGGCCCCGGCTGCAAGATCTCGTTTGGCTATGACCTGGTCGGC
AACAACTACACGGGTGCCAACACGCCGGTGCCAGACAACGACCCGCTGGACTGCAACGGCCACGGAACACACGTGGCCGG
CATCATCGCGGCATCCGATGACCCGTATGTGCTAGGTGTAGCACCCAACGTGACCCTGGGCATCTACAAGGTGTTTGGCT
GCTCAGGCGACGCGGCCAACGACGTGCTGATCGACGCCTTTTTGATGGCCTACAACCACGGCGTCGACATCATCACGTCG
AGCATTGGTGGTGCCAGCGGCTGGCCTGAAGAGCCATGGGCAGCCGTGACGGCGTCCATCGTGGCGGCCGGCACGCCCTG
CATGCTGGCGGCCGGTAATGACGGGTCTGACGGCATGTTCTATGCCTCTTCGGCCTCTGCGGGCGACGACGTGACTTCGG
TCGGCTCGGTCGACAACATCCGAACGCCCTCCGCCTCCCTGCTGCTGGACTACGTCGTGGATGGCGCTTCGACCGAGACG
ACCTACAACGAGGGCTCGGGCTCCTTCACCGGTGTCAGCCTGCCGCTGTATGCCAACTCGTTCAACACCAGCATCACCAA
CGACTTCTGCAGCGCCATCACGGCCAACCTGACCGGCAAGATCGCCTTGATTCGCCGTGGCACCTGCACGTTCGAGGCCA
AGGCCGACGTGGCCAAGAATGCTGGCGCTGCCTATGTCATGTTCTACAACAACATCGCCGGCACGATGACGCCGTCGCTG
GGCTCGGCCTCTCTCACCGGCGCTGGCATGGTCTCGGCTGACGTCGGCACCAAATGGGTCGGCCTCCTCGCGGCTGGCAA
GACGGTCACGCTGACGTTCCCCGACAAGGTCGAGCTGCTGGTCGACCCGACCGGCTCAGCCAACACCGTCTCGGGTGGCC
GCATGAGCACCTTTAGCACGTGGAACCCGACCAATGAGCTCACGATCAAACCGGTCGTCTCGGCACCTGGCGGCAACATC
CTGTCGACGTACCTCTCGGACAAGGGCGGCTATGCCGTCGAGTCGGGCACGTCCATGGCCACGCCCTTTACCGCCGGCGT
TGTCGCTCTCTATCTACAGGCCAAGGGCCGTGGCATCAGCCCGAAGCTGATCAATGCCGCGCTCTCCGGCTCGGCCACAC
CCCTCGTCTTCAATAACGGCACTGCTGACTCCTCGTACCTCACCTCGGTCGCCCAGCAGGGCGGTGGCCTCGTCAATGCC
TATGCTATGATCCGTGGTGGTCTCTCCGTCACCGAGGCGAACCTGGCCCTCAACGATACCGCTCACCACGTCCAGGACGC
CGCCTTCTACGTCCAGAACGACGGCACCACCACCGAGACTTACACTCTGTCTCATGCCCCTGCTGCCAACGCCTATGCTT
TTGATGCTTCCTACACCGGCGAGGTCGCCGAGTTCCCTCCGCCGATGGACACCAAGTACGCTACCGTCCAGATCTCGCCC
TCGACCCTGACCCTTGAGCCGGGCCAAAAGAAGCGCGTGACAGTCGAGGCCACTCCCGATGCGTCTCTGGATACCACCCT
GGTGCCCTTTTACTCCGGCTTCGTCAATATTACCGGCGGAGGCTCCTCCGTCTCGATCCCTTACGGCGGTGTTTCTGGCA
ACATGCACGACATTGTCATGATGTCCGATGACGGCCCGTGGCCCTACGTCATCGGCGGCTTCTACAACACGACCAACACG
ACCAAGACGTACAAGCCATCGGCCGAGACGTATCCGTCTGTCATCTTCGAGTCCCGATGGGGATCTGCCGCCGTTCGCAT
CGACGTTGTCTCTACCACAGGCCCCAACCTTTTGCATGAGGCTGGCATGAACATCACCGGCTCCATCGCCGGCTTTCCCC
TCATGTGGACGCCGCGTAGCTTCTTGTCTGGCACCTGGGACGGCAGCCTGGCCGACGGTACCACCGCCACCAGCGGCACA
TACAAGTTTGTTGTCCGTCTGGCAAAGGTTTTTGCTGATCTGGCCAAGGGCAGAGAGTACGAGACCTACGAGACGGTCGA
GTTTGTTATGGATATGTCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62