GenePrediction:GLEAN_3813 Details

Name: GLEAN_3813
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1037233..1038882 (+ strand)
Length: 1650
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1037233..1037516 (+ strand)
Length: 284
Type: CDS
Source: GLEAN
Position: GCSC_113:1037707..1037969 (+ strand)
Length: 263
Type: CDS
Source: GLEAN
Position: GCSC_113:1038043..1038266 (+ strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_113:1038346..1038882 (+ strand)
Length: 537
>GLEAN_3813 class=GenePrediction position=GCSC_113:1037233..1038882 (+ strand)
ATGTATATCGAAACCTCTGATAAGGAGTGGCTTGTCCAAAAGTACGGCGGTACTAGTCTTGGAAAGCTCCTGGAGCCGAT
CTGCGGCAATATCATACCGTCATTTCTAGAGACTAACCGACTAGCGATCGTGTGCTCGGCTTTATCTGGCACAACGAAGG
CCACGGGGACGACAAGCCTGCTGCTTCAATGCATTTTAGCGGCCGAGGCCGGTCACAGGGCTCAGGGTCAGCTCACAAAG
ACGATCGACCTCATCGCGGAGAATCACATCAGGGTCCTGGACCAGTATCTTGGACAAGAGCAACATCAGAAAACACGATG
TAATAGTGATATTTACAGAGCTGCCAAGATGGAGATCGAAAACCACTGTCAAAGTATAAGGCGGTTTCTTCTTGCTGCAC
AGGTAGTGTTCTTCAATTCTTCACCTCTGCCTTTGATCTGAGAAGAACTGATATGTCGACTACCAGATTGTCAGTGAGCT
GTCGCCACGGTCCAAGGACCGCGTGATATCCCTAGGGGAGAAGCTGTCGTGCATCATAGTGGCAGCCGTCCTGACAAGCA
AAGGGATCCCGGCGCAGGCTGTCTCGCTCGATGATATTGTCGAGTCCGTATTTGGTCCTGCAGTATTGGATCAAAAGGAT
GCCCTCCAAGGTTTGAACAATGAGTTTTATCACTTGCTTTCCAAGGAGATTGCGAGAAGATGCCACGGATGTGAAAAAAA
GGTCCCGGTGGTGACAGGTGAGTGGTGCAGAGGGTTTTGCCAATAATCAATTTCATCACCCAGAGAGATCTGCATACTAA
ATCTCGCTAGGTTTCTTTGGCATAATGCCAGACTCCCTGTTGAAGAGTGTAGGCAGGGGATACTCAGACCTATGCGCGGC
CATGTGTGCGCTCGGCCTTGGTGCCATCGAGCTGCAGATATGGAAAGAGGTCGATGGCATCTTCACTGCGGATCCACGTA
AGGTTCCGTCAGCGAGGCTACTGTCAACCGTTACGGCGGAGGAGGCAGCGGAGTTGACATTCTATGGGAGTGAGGTGAGC
TAACAGAGCCATTACGGCTGTGCTCACAATCCTCTTGTCGGCTGCGAATTTGTGTTAATGGTGATACTAATAGGTGATCC
ACCCCCTCACAATGGACCAAATTCGGTACGCCAATATCCCCCTGCGCCTTAAGAATGTCTTCAACCCATCCGGCCAGGGT
ACAGTCATCTACCCGTCTCGACTTTCGCCGCCATCTACTCCATACGCTCCACTTACACAGCCGTCCAGGAGCGATGTGGC
GGGAAAGGAAAGGACCGATGCAGTCACGCTTCAGCAGAATATCCCGGCTGCCTGTTTCATGCTCGAAAACGGTTACCACG
GCGAGAATCAAATACGTCGGCGACCCACGGCTGTGACGATCAAAGAGCCAATCACCATGGTCAACGTAGCTTGTAACAGA
AACACGCGATCGCAAGGCTTTCTTGTCAATGTGTTCTCTCGCTTGGACGATGGTGGTATCTCGGCAGATATCGTCACCAC
GAGCGAGCGGACCGTGAGCTTTGCTATGCAAGGACACCCCGACTCAGCTGGAGAAGAAACAGGAATAGGGAAGTGGAGGA
AGCTGAAAGGGGATCTAGAGAAGTTTGGGAAGGTGAGTCTCTTGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62