GenePrediction:GLEAN_3814 Details

Name: GLEAN_3814
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1044835..1046732 (+ strand)
Length: 1898
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1044835..1044893 (+ strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_113:1045105..1045426 (+ strand)
Length: 322
Type: CDS
Source: GLEAN
Position: GCSC_113:1045534..1045598 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_113:1045661..1046732 (+ strand)
Length: 1072
>GLEAN_3814 class=GenePrediction position=GCSC_113:1044835..1046732 (+ strand)
ATGTACGCTTGCGTTATGCAGTTCGACTATGTGTTACAGCACCGCGGTCAATATGGAAAGTAAGTGCGGTGTTGGGGAAT
TTGCGGACAGATGCATCTCGCGGCGTCTTCTGTGGAATGCCGTTGAACACTGCCGGACACTTGTTGCCCCCACTGTTAAG
TCCCGCCGCGCTTTGGTATTACGTAACTAAGCGCGTTTGCATAGCTCTACAGCCGGCCGATCCGCAATACCTAATAGCAA
TCGGCTTCTAATTCTAACCAATTCATCGAGCACGATGGCGACGCGACACAGCCTGGCTCAACGCCTTTTCAGCCGAAACA
GGCGGCCATCTCCGACAGCTCGTCTTGCCAATTCCGATGTGCCAGTTCTGCGTGCCTCACCGGCAGCACGCGTCCTGCCA
AGACACTTTCGGGCAGCGCCGGCGCGTCTGACGGACGGTGTCTTCCGGGGCCTCACCGACACCCGGCTGCCGATACCGTG
GATCGAGGCCTTCCGGCTCCAGCAGGAGGGCCAGAGTCTCGGGTTCGAAGAGGCACACCACCATACACGCGACCTGACGC
CGCGAAAGATGCGCGACAGCTACCACCGCGTGGTACGTGAACATGGACAAAGATGAACGAGGGAGCAGAGGAAGTGGTGA
TGGTAGCCTAGACGGTGCGTGATGCGGGGCGCGTGGCTGACGACGACTGCCGTGGACAGGTTCTCCCGCTAGGTCAAGAT
CCCTGGCTCTCGGACACGTACATCAACTCGTCCGGCCACATTCGGTGGGTGCCTACAAGCCAGCGATCCCTTCCCCCGCT
TGCACGTGGTGTTCTGACGTCCTCAGACTAGGCGCCATCTTCATGGATCTGGACGCGCTGTCCGGTATCATCGTGTACAA
GCACACCGGGCCCGGAGTGACGACAGTGACGGCAGCCCTGGACCGGATCGTCATCGCACACCCACTCACCGAGATTGCGG
ACCTCGAGTACAGCGGCATGGTGACATACGCCACGGGCCGCAGTAGTATGGAGATTACGTGCAATGTGGCGCGGGCGCGT
GGCGCAGACGAACCCAGCCGGCCGGAGGATGTGCTGCTGACGTGCACGTTCACGATGGTGGCTCTGGACCCGGTAAATCG
GAAGCCGACCAACGTGCCGAAGGTGCTCTGCGAGACGCCAGAGGAGCAGCAGCGGTTCCAAGCCGGTGAGGCGCAGCTGC
TGGCCAAGAAGCAGGCACTCAAGACGTCGCTGTTGGCGCAGGAGCCTAACGATGCCGAGTCGGCGCTGATCCACCAGATC
TGGCTCCGGCAGCTCGAATACCACGACCCGAACCGCAGCCGCCGGCAGCCGGCCAACGTCGTCGCCATGGCGCGCACGCA
GCTCTCGACCGCGGCCATCATGCAGCCGCAGTATCGCAACCGCCACCAGACGATGATCTTTGGCGGCTACCATCTGAAGC
AGACCTTTGAGCTGGCCTTTTGCTGCGCCGCCTCGTTTGCCCACGCCCGGCCGACCTTTATCAGCGCCGACCCCTGCACG
TTCCGCAACCCTGTCCCGGTCGGCAGCGTGCTCTACCTGACCGCCACCGTCGCTTACACCGATCCGCCTGTACTCGAGGA
GGACGGCCGCGAGCCGGAACATGGCGACCCCAAGAGCCCCGTCACCCGCGTCCACGTCCGCGTCGACAGCAAGGTGCGCG
ACGTCGACCATGGCTATGCCCGTGCCACTGGCCAGTTCAACTACACCTTTTCCGTGCCCAAGGATGTCCGCGTACTGCCA
CATACCTACGAAGAGTACATGATGTACGTCGATGCTCGCCGGCGTGTCATGGCGGCTGACTCGCAGAAGCCACCCGTCGG
CACCGCTGCCGATGTAGAACCCGGCCCGGAAGCGGGCGGTGTCAACCTGATAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62