GenePrediction:GLEAN_3815 Details

Name: GLEAN_3815
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1048488..1049920 (+ strand)
Length: 1433
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1048488..1048907 (+ strand)
Length: 420
Type: CDS
Source: GLEAN
Position: GCSC_113:1048972..1049188 (+ strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_113:1049268..1049476 (+ strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_113:1049537..1049920 (+ strand)
Length: 384
>GLEAN_3815 class=GenePrediction position=GCSC_113:1048488..1049920 (+ strand)
ATGCCCCACTCGGAACCCCTAAATACCGCTACGTCATGCATTGAGGTGGTGCCGCTTCCAGCTTTGGAAAGACTCAACAC
CCTACTAGGAGCAGAGGTTAAGCTGGCTCCCGGCGGAGACCTCGACCACTTATCGTCCGACGACGAGAAGAAGCTGGTAG
ATGCACTGCACGAGCACAGCGTCCTCGTTGTGCGACGAGCCGGCATCAAGCACCCATCGACAATGACTGCTTTGTGTCGC
ATCTTCGACAAGGATGCACTGGATATGCACAGCTACGGAAAGACGGCCGTACGTGAGAAGACAAATGTGCTCAGTCGCAA
CAATGCTGGCCGTCTTAAGGGCGATCCCAACGTCGTCGTCATCGGCAACGGCTTCTACGAAAACTACGATGGGGGTGAAG
ACCTACAGCTGCGGCATGTGGTTCGTCTGCCCGGGCCGAGACCTGTATCTCTTCATCTGGGTGCTGACGCATCGGGTTGT
ATAGACCCAGGCTGAATTCCATGCGAAGCCGCTCACAGAGGCAGAATTAGCCGATGGCCAGACGCGATTCTATCGGTGGC
ACCTCGACGCCCCTTTGTATGAGCGATATCCGGGCAAGGTGACGATTATCAGCTGCCAGGAAACCCCTGGCTATCTTCCC
GATCAGAAGATTGTCTTCGAAGATGGTAGCGTTAAGAGCGTCTATCCCGGCGGCACTGCTTGTGAGTTGAAGTCCTTCAG
CCCCGGCTTTGCAATGCTGCTTGTTCGCCCTTCTTACCTGTTACTCTCACCTGTTTATAGATGTTTCCGGCGCGCGAGCA
TTCAGCCTTCTGACACCCGAGGAGAAAGAATGGGCTATGAACACAAGGGTTCAGTACGCACCTCGAGCGTATAACTGGAT
CGGTGACTGTAAAGCTACATCGGATGGCCTTACTATTGAGAGCGAGGGAAAGGAGCGTGATTTCGATTCGATGGAGCCGT
GGACTTGGGACAAGGCTCACTGTTATCCGGTAGGAAGTCTCAGCCATCATGGAATATCTGCACATTGATCTTAATAACCA
CACACACAGCTCGTCTTCCGCAACCCTGGAAAGCCGTCTCGGCCTCACCTGATCGCCCTTGGTTGTTGCGTGTACAGCCT
CATCACCACGGATCCTCGTACTGGCAAAGAAACGACCATTTCGGACTTTGGCGAGGCGCGCAAGAAAATCCATTCACTCA
TGAAACGGTCCATGAGCGACCGCTACGTCTATGTGCATCGATACGAGCCCGACGATCTCGTCATTTGGCACAACCGTGCC
GTCTGGCATTCAATCACAGGCGAACTCGGCAACTCCAAGCGTCTGATGTGGCAAGCAGCCAACGGAAGTCCATATGCTCC
ACAGGCCGCTCAGTGGGACGAGGTGGACATTGAGGGAAAGACTTGGGCAATGGATATGTGTGTTGGTGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62