GenePrediction:GLEAN_3819 Details

Name: GLEAN_3819
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1078637..1079920 (+ strand)
Length: 1284
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1078637..1078879 (+ strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_113:1078940..1079920 (+ strand)
Length: 981
>GLEAN_3819 class=GenePrediction position=GCSC_113:1078637..1079920 (+ strand)
ATGCAGGCATTCAATCCAAAGGTACACCTGGCGTTCGAGCCGCCAAAGGCGCGGCACTCCTTCACGGAGCTGGGCCTGGA
CAGGCCAAAAAATACGCCAGACATGTGTTTTACGGAGCCGTTCCCACTGTTTTCGCCCGAAGGTGTGCGCATGATTCGCC
GCGAGCTGCTCAGCAAGAAAGTGCTGGACAAGCACCTAACATCTTGGCCGCGGGCGCCGTGCATTATCAGCGGCCATGAG
GAGGTACGTCCTTGACTGTTCCGGGAAGAAAGCGAGGGGCTTCGATTGACGCTGACCGGACAGACGGCGACATGGATCCG
GGAGATGTGGTGCCACCCGGCCGTGCGAGAAAGCGTGGAAACGGCCTTTGGGCTGCCGCTGCAGATCCTAGGTCGGCGAG
GAGAGATTGGGCACTGCAACGTGCAGCTGGGAGCAGGAGGAGTTGAGGCCGTGTATCAGCTGGGAGAGGAGGCCGCCCTT
GACGAGACAGACGGGACGAGCGTGAGCACCAAGGAGAAAGCCGAGCAGGCGGACAGCCAGGGCGTCGAGTCGGCGTACGA
CGACGTGCTCACGGACGCCTGGCACCGAGACTCGACGCAGGTGGTGGTTGTGGTGATGCTGAGCGACGCAACGACGATGG
AAGGTGGCGAGACAGCGATCCGCGATGGCAGCGGCCACGTCTTGAAGGCGCGGGGAGCGCAGGCTGGCAGCGCGGTGCTG
ATGCAGGGCGCACACACGTGGCACGCAGCGCTGCGGGCGACAGGGGGCGCACATGAGCGCATCAGCATGGTGACCAGCTG
GCACTTCCGCGATGCCGACTTGGACGACAGCGGCACATCGCTGCGCAGTATCCGGTCCGACGAGCCGATGGCGGCCTGCA
TCCAGGACCACTTCTTTGCCCACAAGCTGCGCAAGCTGCGCGACCGCATCGACGTCCAGCTTGACCGACTCGAGGCCCGA
CGCGTTGTCCCGGCCGAGGACCCCGACCGGCCGCTGCTCGGCCGCGCCGTCGTCGAGGAATGGGTGGGCAACCAGCTCGG
GCTGCTAACCCAGACCGCCTGGGAGCTGTGTGAGCGCTGCCCCCGCTGGCTCTACCAGGACGTCCCACCGGCTGTCATGG
CCGACTACGGCTGCCGTCTGGTCGTGGACAGCACCAAAGACGCCACCAGCAGCAGGCTTCCGATCGTCTCGCGCGTGTTT
TCTCCCGATTGGGACATTGGCTTTCTTGCCGGCCTGTTTGCCGGCATCTCTGTGGCCCTGCTGTCGGCACGCAGCGTGCG
ATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62