GenePrediction:GLEAN_3820 Details

Name: GLEAN_3820
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1082906..1084726 (+ strand)
Length: 1821
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1082906..1083140 (+ strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_113:1083210..1083530 (+ strand)
Length: 321
Type: CDS
Source: GLEAN
Position: GCSC_113:1083583..1084272 (+ strand)
Length: 690
Type: CDS
Source: GLEAN
Position: GCSC_113:1084338..1084726 (+ strand)
Length: 389
>GLEAN_3820 class=GenePrediction position=GCSC_113:1082906..1084726 (+ strand)
ATGATGGCCTCCGACAATAGAACCTCTGAGATTACTGGAATCGTCGTCGACAGCGTCCTCAAGGAGAAGGACCCTCATGT
CGTCGAGGTCGGCGAGCTGACCGTCTCGGCTAGGGCCCGCGAGCTTGTTGCCGAGCTCGACAGCGAGCTGCCCACCGGTC
GCTGGGAGCTCTGGGCCTGGTACGGCTACTACTTTGCCAACAACAGCGCCGGCACGCTCAGCTATGCCCCTCTGAGTATG
TGGCATTGATACAGGTTCTCGTCGATTCTTCACTGTCATCTCTCACCCTACTCACATCCTCCAGTCTTCCAGTCCATCCT
CAGCCAGGTCGGCCATGATGGCAACGACCCCAGCCAGGACTGCAGCAACAGCCTAGACCCCTGCGTCGTCAAGTTTGGTA
GCCGCACCATGAACATCGACACCGTCACGCTCACCTGCAATGGCATCATCTTTGCTTTCAACGGCTTTCTGCTTCTGCTC
CTCGGTCCAATGGGCGACTACGGCCGCTGGAAGCGCTGGATCCTACTGGCCTGCACTCTCATCTGTTGGACCACCCAGTT
TGCCTTTCTGGGTCTTAAGAACGGAGGCCAGTATAAGGCTGCTATAGTGATCTACATCCTGACGAGTTAGTGATTAAGCC
CTTCTATCCCGCCTTTTCTATTTTCTAATCCCCCCAGCCGTCTCATACAATCTCTGCCAAGGCTTCTGGCAGCCCTCCCT
GCCGCTGCTAGCCCGCAACACTCCCGCTGCCAGAGAGACCAGACAGGTGTTTGTCCGCGGTGAGATCAGCGAGGATGAGT
ACGTCCACTGCCAGGTGCTGCAGCGCAATAAGCTCAGCAATATCTCCTTTGCTGCCATGAGCATCGGCTACACCATCGTG
CTCATCATTGCCATCGGCGCCGCCTTTGGCCTGCACGCCGATGCGTCCACAGCCAACAACACCCACGCGGCCGTTGTGAT
CGTCGGCATTGCCACCGGCTTCTGGGTCCTCCTCGGCTCTCCCTGGTTCTTCCTCGAGAAGAAGCGGTCCCAGCCTCTGC
CACCCGGCCAGACGTACTTTTCCGTCGGCCTCAAGGCCTACTGGCAGCTCCTCCGCCACTGCCGCAAACTCGGTCAGACA
TGGCTCTACCTCTGCGGCTACTTCATGCTCGCTGACGGCTACGCCACCTCCAATCAACTCGTCGGCCTCTGCCAGAACAG
CATCGTCTCCTACAACACCATCATCTCCACCGAGCTCTACATTGTCGCTGGCATCTCCAACGTCGTCGGCATCGCCATCC
TCTGGGCTGTCCAGCGCTACTGGCGCATCTCCACAAAACCCATGCTCATGTGCATCTGCGGCTTCCTTCTCGTTGTCCCC
GTCTGGGGTAAGTCTCCCTGACCTGTCTTGGTCCTAGACCCACAAGAGTACTGGCTCTGACATACCCTCCAGGCTGTATC
GGCATAGGCACAGACAACTTTGGCTTTCACAAGGCCTGGGAGATCTGGGCCTGGAACGTCTACGACTGTGCTGCCATTGC
TCCCTTTTATGCCTTCACGGCCACCATGCTGGCAGACATCATCCCAAAGGGCCGTGAAGTCACCTTCTTCTCTCTCTGGG
CCCTCTTTGGAAAGTCGACTGCTTGGATTGGCCCCATCATTTCTGGCGTCATTATCGACCACACAGGCAGCACATGGAAG
GGTTTTCCGTTCTCACTTGGCCTTAGTGTTGCTGGCTTCGCTCTGATCGCTCTGGTAAATGTGCCCAAGGCCAGAGGACA
ATGCGCTATTTGGGCTGAGAACGATCCAACTCTAAGCAAGGACAAGCGAGAGACTTCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62