GenePrediction:GLEAN_3821 Details

Name: GLEAN_3821
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1089034..1089899 (+ strand)
Length: 866
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1089034..1089094 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_113:1089160..1089899 (+ strand)
Length: 740
>GLEAN_3821 class=GenePrediction position=GCSC_113:1089034..1089899 (+ strand)
ATGGGCCGACCTGTATCGCCTGAGCGATCCCAGATCCTTGACGCCGAGATTACGGAAGAAGGTGCGGAATCCTGTTTTGC
GCCTGGCATGATTGCGGTCACGATTACTGACCGCATCCAAATGCAGCAGCCGTCATTGTGTACCAGACGCCCCGCAAGGT
AATTTCGGTTCTCGAAAATGGAATTGCAAAGAAATGGACGCGGGGAGACTCTCAGCTGCACGAGATGGAGGCACTGCGCG
TTGCCAAAGAATGCGGCCTGCTCGTGCCAGATGTGCGTGGTTATGGGACGACACCAGCGGGGAAAATATGGCTGGCGATG
GACAAGATCGCCGGCCAGCCGCTGGAGCAAGTGTGGAAGGACCTGTCCAAAACGAAGAAGACGGCGATTGCCCAGCAATT
AGGCGCCTTTATGGCCCAGAAACGCGCTATGCCCCCACCAGAGGGGCACATTGGGGGCCCAAGGGCTGGCCAGCCAGGGC
GCGAGATCCGCCAGTACCACGACTACGAAATCCCCGCGTGCCGTGATGAGAGCGAGTTTAACAAATACCTCCTCGGTGCG
CTTCTTTGGAACACGCCTGTGCCATTTCGCAATGCCTTTGCCGAGTGCCTACGCGCCGACCATCGCATCGTCTACACACA
CGCTGACTTTGCCCTGCGCAACATTATGGTCCAAGATGGGCAGGTGACGGGCGTTCTTGATTGGGAAAATGCGGGATGGT
TCCCAGAATACTGGGAGTATGTTAAGTTCTTTCACCAAAACTTTGGTAACAACGACTTCCGTGACTACGCCGACATTATC
TTTCCGCGCAGTTTCCCCAACGAGCTCATTACCTACACAGCCCTCCTTAAGTACCAGTATCCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62