GenePrediction:GLEAN_3822 Details

Name: GLEAN_3822
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1098373..1101625 (+ strand)
Length: 3253
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1098373..1099641 (+ strand)
Length: 1269
Type: CDS
Source: GLEAN
Position: GCSC_113:1099705..1100220 (+ strand)
Length: 516
Type: CDS
Source: GLEAN
Position: GCSC_113:1100279..1101625 (+ strand)
Length: 1347
>GLEAN_3822 class=GenePrediction position=GCSC_113:1098373..1101625 (+ strand)
ATGCCATCGCAGCCGCTGCCAGGAGGAGGCCTTCCGCGGCGAAGCAGTTCTGGGCTGCCGCCGTTGCAGGAGCAAGAACA
CCGGCCAGCGGTTACATCGACATCGACATCGGCGCTGTCGGTGCTGCCAGGGTTGTCGACACGGGCTCTGGCGCCACAAA
CGCACGAGCTGCGGACAGCCCTGGCCGAAGGAACGCTGGTGACGCGGTTCCAGGCTCTACTGATGCGAGACGACACGCGG
CAGGCGTTGTTTCGTGAGCGGCTAACGGCAGGCCAGCTGCAGCAGCTGTTTGGGCTGGGACTACCGCCGACACTGCGTAT
CATGCTGATGAACACGCTCGGCGACGTGGCTTGGTTCCGCGAGCTGCCGGCGACCGAGCGAACGGCCGTCGAGACGCGGT
TCCGGGCACAACCAGGCGACGGGACAACAGCCACGCCGATACCAGTGCCAGTGCCATCGCCATCTCCATCCCCGATCCCG
GTCGAGGTGAAACGACCCATATTCAAGGCTCGGCGAACGGGACGGTCGGTGCTCTCGCCCACGGCCAACAGGCTGCTCCT
GCACGACCGGCGCGCATCCTCCGGCAGCAGGCTGTCGACCACGTCGTCGACAGCCTCGTCGGTCGCAGCAGCTGATGCAA
AGGCCCGACGAAGGGCGGCTAGTGACCCCCCCGTTGAGCCGCAGCCGGCAGCCATCGCTAGCGACTTGCTACCGCCGAAA
CGAGCCCTCTCCGAGGCTGAATCGGACAGCAGCAGCAGCGGCAAAAAGAGAAGCAAGCGCCCCAAGCTGATGGGCCCCGA
GACGTCGTCCGAGGCATTGTCGGCAAAAACTCCGTCTGCTTCCTCGTCTGCAAGGAAGAAGGCGAGCGTGCCTGCAGCCC
GTGAAATCATCGAGATAGAAGACGACGACGACGAGGTTGCCAAGGACGCCGATGAGACGGAAGACGACACGTCCGACAGC
AACACCTCGGAAGACGAGGTCCTGGCCGACACGACGCGCTCCTCTGGCTCTGCTGCCGCACCCCAGCCGCCCAGACGGAT
CCTGAATGCACTCAGCGGTCGCCCCTACGACATGTGGCAGGGCAAGGAGCTGCTCCTACGCTGGGACGGCTTTCCGGACG
ACCCACACGAGCTCCTCGAGACGGCCAAAGGCGCCGCCATTCCCGACAACTACCAGCTCTCCGGGCCGCTGGCCACGCCT
TGGGTCTGCCCCATCCGCCCGTGTGGCCGTCACTTCTTGTCGCTGGCCAACATGGGTCTCCATTTCAAGGTGAGCTGGCC
AGCCGTCAGCCTGGCTAGCCAATGATGCTTACAGACCTCTACCTTGTCTCAGATTAATCATCAGTTTGCCCTGCTCCATG
ACAACCTCGACGGAAGCTTCTCGCCGGTGCCGGATGTGGCCAAGGCACCAGGTCAGCTCGGTGTCTGGGTCATCTCCCGG
GCGAAGCCGAAGCCGAAGCCAAAGCCGCAGTTGCAGTTGCAGTTGCAGTTGCAGCGGTCGGAGAAGCCAGCCACAGAACA
GCCACCGGTCCTGCCGCAGCTGTCCCAATTCCGGTCCACGTCTGGCCCGGTCATTCCAAAAGACACGGCGCCACGATCAG
AGAGAGAGAGAGAGCGGCCAGATCGACGTCTCCTCCTCAAAAACGAAATCGTCATGGCCACGCCCGGTCGCGAGTACCTG
GTTCTTCCGCTCGAACTTCGTGGAACAGAGAAAAACAACAGCAGCTTTGGCGTGCCGTTGCCCGACGGCTACCAGTATTC
CACATACCCGAAACATCCGTGGATCTGTCCGGTGCGCACGTGTCGGTCTGTCTTTCTCCGCATTCCCAACCTGGGGGCCC
ACTTCACTGTAAGTCTTGGCTGCAGCGTCTCTCTTGGCCTCCTTCGCTGTTCCCGCTGACCGTCAGCGAAAACACCGCCG
CCGGCTGCTTAACGACAACGGCGACGGCACGCTCTCGGAAATCGGCAAACACGACGCTGCCCGTGGCATTGTGGTGTCGC
AGACCCGCCGCAAGGCCGCCGAGCTCGAACCGCTAGCCGTGCCGCTTCCGCCGGGATACAACACAGCAACAGCTGTAGCG
GCAGCTGAACCAACAGAAACAACACCTTCTACAGTTTATAATACAGTGCCTCATGAAGTTATCGACACTGTGCTCTTAGG
ACCTTTGGCCCACACGACGCCGACGTGGGAGTACGCCCAGTCACTGCTGGTGCGGCACTGCGAGCAGATGCCGACCAAGG
GCTACGTGCCACTGTTTGCGCAGCTGGCCCGCCTGCGCGACATTCAGTGGAACGAGCTGTGGACGGCGCGGCACCCGTTC
CACGACACGCTGCCGCGCGACGTGTCCAGCCTGATCTTCCAGCTGACGGGCGAGCGCAACAAGCTGCCATGCCAGTACTG
CCGCGAAGGCAAGGGCCCGTTTGCGGGCTGCGTGATCCTGCCGGTCCACGCGCCTGTCGAGCTGCACGCTGCCGTCACGT
GCTGTGCCAACTGCCTCTATCACTGCGGCCAGGCGGGCTGTTCGCTCAAGACGCACCTGCGCGACCGCTTCGGCGTCCTC
TTCCCGGACGTCGACCTGGACGCCGAGCGTCACCGTCTCAACCTGCCGTCGACGTCGTCAGCCGACGCCGTCACGGATGA
CAGCCTAGACAGAGGCCCAGCTTCTTCTGCCTTTAGCCGCCGCTCCGAGCGGATCGCCGTGAAGGAGTCCGTGGCCGATG
GGCTGGCAGCACCGGGAACCGACAGCGCCGGCATGGGCTCTACTTCGGTCAAGCGCAGCCGCTCGGGCAACGCCACGCCG
CAGCCGGCTCCAGCCACCGTCATGACCGGCGCCAACGCCTCCATCGCCGACTCGACCGGCCAGCTGCTCGAGATGGAGGA
CTGGAAGGTCGCGCCCGGCCACGTCGAGGTGCAGCGAGCCGCGCGTCCCGGTGGTGAGATCCGCACCGAGAGCGTCGCCT
TCTCCAACGCCTACCTCACCACGCCCGGCCAGCTCGTCCGCATCGACCACAACCTCTCCTTCTGCGTCCAGGTGGTCCGC
CCGGGCGCCACCCAGGTGTTCAACCCCGATGCCTCCGCCACATACGTCTGCTCGCTGGCCGCTGGAAAGCTGCGCGTCCG
CGTCGACGACGCCGAGTTCATCGTCGGCCCCCACAGCATGTTCCAGGTTCGGCCCGGCCAGTGCTTCACCGTCCAGAACC
GGCTCTACGTCGACGCCTACCTGCACATGTCCGCACTACGGAACCTGCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62