GenePrediction:GLEAN_3825 Details

Name: GLEAN_3825
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1125204..1128598 (+ strand)
Length: 3395
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1125204..1125572 (+ strand)
Length: 369
Type: CDS
Source: GLEAN
Position: GCSC_113:1125627..1127892 (+ strand)
Length: 2266
Type: CDS
Source: GLEAN
Position: GCSC_113:1127961..1128598 (+ strand)
Length: 638
>GLEAN_3825 class=GenePrediction position=GCSC_113:1125204..1128598 (+ strand)
ATGGCAACAAAGGGTGCTCATTTCGACGATTCGGAATCCGACGATGACAACTTCAATCCAGCTCCCGCTGACCTGTCTGA
TGCCGAGGATGATAATGGCCGCGAGGCAAACGCGGTCGCCTCGAGCTCGCCGCGCCGAGAAGACGACGACGACGTGAAGT
CGGAGCCCCGAAACCAGAGACGACGTCAAATTGACGCCGACGATGAGGAGGAGGATGACGGTGAGACGAAGACAGAGAAG
AAGAGGAGCCGACACGTGGAGGAAGAGGATGAGGATGAGGACGGCGACGAAGACAACGAAGAGGCCGATGAGGACGAGGA
TGAGGACGAGGATGATGAGGAGGACGAGGATGACGACGTGCAGGCTTCGGTAAGATTGCAGCTAGCGGCCGGACGGCAAG
CATTGTTCTAACACGGTTGGCAGAGACACAGGCGCAAACGCCATAAGCGCGACAGCCGAGCGGCGTTCTTCGATATCGAG
GCCGAGGTGGACGACGAAGACGAGGCCGAGGACGAGGAGAAGGAGGGCGAGGAGATTGAGGATTTCATCGACAACGCGCA
TCCGGACGACCTGGAAGAGACGAACAACCTCAACGACGACCGGAGACACCGGGAGCTGGACCGACGCCGCGAGCTGGAGC
AGAGTCTGGACGCAGAGAAGCAGGCAGAGATCCTGCGGCAGCGGTACGGAAACCGTCGGCCGGCGAAGGGACTGGGCGAC
TCGGCGGTGGTGCCGCGGAGACTGCTGCTGCCCAGCGTGGAGGATCCGAGCATCTGGGCGGTGCGGTGCAAAGAGGGCAA
GGAGCGCGAGGTGGTGTTCTCGATCATGAAGCGAATTGAGGAGCGGATGGGCACGAAGGAAGAGCTCGGCATCACGGCGG
CGTTTGAGCGCGGCGGCCCGCAGTCGGTGATGAAGGGGTACATCTACGTGGAGGCGCTGCGACAGACGGACATCATGACG
GCGCTGGATGGGATGCTGAACGTGTACCCACGCAACAACCTGATCCTGGTGGAGATCAAGGACATGCCAGATCTGTTCCG
GATCACCAAGACACCGACGCTGGAGCCGGGAGCATGGGTGCGGCTGCGACGGCCGGTCAAGTACTCGGGCGACTTGGCGC
AGGTTATGGACGTGACGGAGAACGGGCTCGAAGCGCGGGTGCGCTACATTCCGCGTCTGGACTACGGGGTGCGGGACGAG
TCGCTGGCGCTGATGACGGCGGAGGGAAAGCGCAAGAGGGTGCCGGGAGTCGCAGGGCCGCGGCCACCGCAGCGGCTGTT
CAGCGAGGCGGAGGCGCGGAAGCGCAACCCACGCAACATGATGGCGCACGCGCAGCCGAACACGTGGACCTTTAACGGCG
ACTACTTTGAGAACGGGTTCCTGGTCAAGGACATCAAGCTGCAGCAGCTGGTGGTCAAGGACGTGAACCCGACGCTGGAG
GAGGTGACCAAGTTTGCGCTGGGAGCCGAGGACGGGACGGAGAACCTCGACCTCAAGGCGCTGGCGGCCAGCTTGAAGGA
CAGCAACGCAAACGTGACATATGTTCCGGGCGACGTGGTGGAGGTGTACGAAGGCGAGCAGAAAGGCGTGGTGGGCAAAG
CGGTCAGCATCGTGGGCGATATCGTGACGATCGATGTGACCGAGGGCGACCTACGGGGCCAGACGATTGAGGCGCCGACA
AAGGGACTGCGCAAGCGGTTCCGGGCCGGCGACCACGTGCGGGTGATTGGGGGGCGATTCCGGGACGACGTGGGCATGGT
GGTCAAGATCGAGGAAGACCGGGTGACGCTGTTGACGGACCAGAACAACTCGGAGATCACGGTGTTCAGCAAGGACGTGC
GGGAGGCGAGCGACACGGGTGGACAGGGAACGCTGGGGCAGTTCTCGCTGCTGGACCTGGTGCAGCTGGACCTGTCGACG
GTCGGCTGCATTGTCAAGATTGACCGGGAGTCGCTGGTGGTGCTGGACCAGAACGGAGACACGCGGCAGGTGATGCCGTC
GCAGATCAGCAACAAACTTCCGAAGAACAAGATGGCGGTGGCGGCAGACCACAGCGGGTCAGAGATCCGGCTGGACGACG
TGGTGAAGGAACAGGGCGGCCAGCGGCGACAGGGCAAAATCATCCACATCCACCGTTCGTTTGTCTTTATGCACAGCAAC
GCGACAACGGAGAATGCGGGCGTTTTTGTGACACGGGCGAGCAATGTGAACACAGTGGCAGCCAAGGGCGGCCGCGTGAG
TGCAGCCGCGTCGGCTGGCCCCGATCTGGACAGCATGAACCCGGCGCTGAAGCGGAATCCGGGCGGAGCAAACGGAAATG
CGATGCAGGCGCCACAGCGCGTCTTTGGCCGCGACCGGGCTGTCGGCCAGACGGTCACCGTGCGGCGTGGCGGCTACAAG
GGCCTGCTGGGCATCGTCAAGGACACCACCGACACGCTCGCTCGCGTCGAGCTGCACACCAAGAGCAAGACCATCACCGT
GCCCAAGGCAGACCTGATCTTCAAGGATCGCGTGACGGGACGGTCGATCGACATCAATGCCCGTGGCGGGCGTGGCGGCG
GCGGCATGGGTGCCGGCAGCAGTGGGCTCGGCCGTGGCTCGGCACCAGCCTGGGAGAATGGCGGTGGCCGCACGCCGCAT
GGTGGCAGCGGTGGTGGCGATCGGACGCCAGCCTGGGGTCTCGCAAAGGGTAGGTTGAGCTTCTGTCTTTTTCTGGTGTC
TCCACTGTTTCTGACTAATGCTGACTAACACAAACAGCTACCTCGCACACGCCAGCCTGGAACCGCAACGACGCGTCCGG
CTCTCGCACGCCCGCCTGGGCCGCAGACGGCTCCCGCACGGTCAATCCTTATGATGGGAGCCGGACGGCGTACGGCTCTG
GTTCGCGCACGCCGGCATGGAGTTCCGGTGCCAAGACGCCGGCTTACGACGGATTTGGTCTCGGGTCCAAGACGCCGGCC
TGGGGTGCCAGCAGCGGCAGTGGTGGTGGTGGCGATGCCTGGGGATCGGGATCCAAGACGCCCGCATATGGCGTGTCGGC
GCCGACGCCGGGAGCCAGCGGCAACGACAACTGGGGCTACACGCCGGGCATTGGCTCTGGCCAGGCCTACGATGCGCCGA
CGCCAGGTGGCGCCCTCAATGCGCCGACGCCAGGAGCTCTGAGCGCACCGACACCAGGGGCCTATGCGGCGCCGACGCCC
GGAGCCGCTCTGAGCGCACCCACGCCCGGCGCCGGGTGGCAGGGCGGCTGGGGGGCCGACACGGCACCGACGCCGGCTGG
CGCACCTACACCAGCAGCTGGCGGCGGCTACTACGGCGCACCCACACCGGCTGCCTATGGCGGTGCACCAGAGACGCCGG
CAGCGAGTGGGCCACGGTACACGGACGACGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62