GenePrediction:GLEAN_382 Details

Name: GLEAN_382
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1421996..1423860 (+ strand)
Length: 1865
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1421996..1422148 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_167:1422230..1423394 (+ strand)
Length: 1165
Type: CDS
Source: GLEAN
Position: GCSC_167:1423556..1423860 (+ strand)
Length: 305
>GLEAN_382 class=GenePrediction position=GCSC_167:1421996..1423860 (+ strand)
ATGGATTTCGATATCGAGATGGAGGATGCCGCTGGTGGCTATCCGGGCGAGGCAGCACCGTACGAGGCAACACACCATCC
AGACGATATGCCGCGGGACGACACGGATGATATATTGGGCACAGACGCCGACATAGACACGAGAGACGGACAGGTAAGTG
ATAGGTCCCAGTTGGCAGAAGACAGCCATTTATGACTACTAGGGCATCTGCTAAGCTGACTTTAACAAAAGCAGGAGCCT
GGCGAGATCGACGAGGCCGTTCAGGCGATCGACGCGGCCGATGTGGCTGCCGAGGCTATTGTCCCTAACAAGGTGCACCT
ACGCGGTCTCGACACACTCACACCAGACGACCTCAAGGCATACTTCGCCGAGCACGCGGGAGGCTCCGGGGGCTTCGATC
GCGTCGAGTGGATCGACGACTCGTCAGCCAACCTTATCTTTGGCTCCGAGAGCAGCGCTGCAGCTGCTGTCACAGCCCTC
TGCGCTATGCCTATTGCCGACGCCACGCTGCTGCCGATGGGTGAACTGCTACCGGCAAAGCCATACACAGCCAAGGCCAA
GAGCGCGGCTGACATGGCCACGACGAGCGGACCCGGTCTGCAGGTGCGCTTTGCCGTCACCTCGGACAAGAAGCAGGCGG
GCGCGGCCTCGCGTAGCCGCTTCTACTTGCTGCACCCGGAATATGACCCCGAGGAACGGCAGAACCGGAGGCAGAACCAG
CGAAGAGACGACCGGCGTGGCGGATCAGGACGTGGCCGCGACCGTGACTATCGGTCCAAATATCGATCATACCGGGAGGA
GGACGACCGGGCTGCAGACATTCGCAACAACTCCTTCGACGTCAACCTGTACGACGATGATGCGCCAGCACTGGCGGCGC
GGACATCGCAGACATCGCGGTCCCGAACGTGGTCTCGATCCCAGTCGAGGTCTCGATCGCGGTCCCGGTCTCGACGACAT
GATGTCTCACGCCGGAGCCAAGCTGACAGAGAGCTGTTTCCCGGCAAAAGCAAGGAGCTGTTCCCCCATAAGGTAGGTGG
CGAAGGCAGCACTGAAGACGGGCGGACAACACCCACCATTGTTGCTACTGCTGCTTCCGGGGGCCGCAATCGGGGCAGAG
GCAGAAACGGCAGACTGCGCAGCCGCTCAGCATCGCCTTTGCACGATGACGACGACGATTACGACGGCCGGCGCGCAGAC
GCACGTGCAATAGCATCATCCGAGGCGGCATTGCGCAACCGCGACAAAGCCCGTACGCTCAAAGACCGGTTGTCGACGAC
AAAGCCTGCAAGCGAAAGCGGCAGCTTGGAGCTATTCCCAAGAAAGACGATAGGAATGGCCCAGATGGACCTTCTCGGCG
GACGGGATGGCGCTGCTGCGCTCACTTCGCGACTCAGTGGTATGTCGGTTTCCTTTTGACGGCTTGGGAGAGATGGATCT
TTTCTGTTGGTTGGACGACTTGTCGAAGTTTGGCAGTCACAACAACGAACCCAAAAGACAAGAACAGGTATCGGCCAGCG
GAACACCGTTAACATTAGTGACCCCCTCCTTTTTCTGCAGATCGAATCACACGTCCTTCAAACGGAGAGATCTCCAAGGT
AACAGCAAATGGAGATGCCAACGGCAGCGGGAGCACATTCAACATCCGTGGCATTTCTCGCCAACAGCCAGGAGGCGGCG
TCGGACTAAGCATCAAAGGTGCCGCCACGGCTCGAGAACTGTTTCCAGACAAGTTTGGCGGCGAAGGCGGCAACGGCAAC
GGACACGGTTCCAGCAGCGGCCGCAATGCTGGCAAAGAGATCTTTTCCGACCGGCTAGAGAATCGGACTCGGCCGCGCCA
GCGCGCAGAGGACTTGTTTCGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62