GenePrediction:GLEAN_3830 Details

Name: GLEAN_3830
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1176828..1178226 (+ strand)
Length: 1399
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1176828..1176857 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_113:1176919..1178226 (+ strand)
Length: 1308
>GLEAN_3830 class=GenePrediction position=GCSC_113:1176828..1178226 (+ strand)
ATGCGCAGCACTGCACAACTTTATCCTCCGGTACGGATAGCTGGCCGACGGGCGGTCGTTGGATGATTTGAACAATAATC
CCTTCTTTGAGCGCTATGACGACGCGGACGAGATCCGTGACCGGCTACATGACTCTCTCGTTGCCTTCCTCGAGGCAGCC
GAGATCCCAAAAGAGATGTGGACCTTTTACTTTTGGGTTTCCGGCATCGCCGAGCCGTCGGAAATGTTCCAAGATGGGGT
CAGCAATGGCGAGGCTGACCGCTTTGTCGTGCTGTATACGACAAACATTGGCCTTGCTGGGCATTCGACCGGACTCGTGT
ATGATCAGCGCACCCACCGTGCCACAATGGCGCTTGGAATAGAAGATCTCGACTTTTCACAGCCACCCGAGCAGCATAGC
GACCTTTGGCACCCGCTGGAGACGGTGCTCACCCAGTGGATTGAGATGATCCGCATCGGAAAGATCACGGCATCCCCAGA
GGACGAAGGCGATGGCGACGATAGCGACGAGCGTGTTGGGAGTGAAGAGGGTGATGCGGCCGGCAATAGAATAGAAAAGG
CCACAAACGAAAAGTTGGGGCCTTGGACATGGCACGCATACAGCGCAACGCAGGTCGACAGCGCCGTTGCTGCATCCAAC
AGGCTAGCCTCTGCCATTGAGAGCCGCATGCCCGAGGGCTCATTGCTGCCGGAAAGCGCCAGTCCTCTGCTCCGCGACGC
CGACTTGGATGCTGCTGCCGTGCCAGCCAACTGCTTCATACGAAGCTTCTTAACCCACATACGTCCGCCTCGGTTCAGTA
CTATTGCGCCCGGCCTACTTGTGCCGCACGATGCGGCGCGCTTTGCTCGCCAGCAGAGATTCACGCGCATGGACTACGCC
TCTGCAGACGACGGCCAGCACATTATACCGCCGGTACTGATCTTTTCCGCCGAGGGCGACCGCACTGTCAACTTTGACTC
GGACAGCCGATACATCTCGCACAATCCCTTCTGTCGGGCTTTCGCTGATGGTGTGCCGGCCGGAGACCATTCCGTACCGG
CAGGCCTCTACAGCGAGTCGGTGGAGCGCACTGCTGTCGACAATGCCGAAGAAGGTTTCCGGCTGCTCCTGCCGTATTGT
CTTCGCGAAGCCGGCCAGGAGGACTCTGGGGCCAAGAAGAGTGATGGTGGTTACGTCGAAAAGAAGAGTGTCGCCGACTT
GTTTCAGCATGGTTTCAAACCGTTTGGGGGTGAATGGTGGAGGGCGCAGCGGCTGGAGAGGCTCTTTGATCGCTGGCGAG
AGTTGGTCGAGAGTCGCGTCTGGGCCGTTTGCGAGACAGGGGTCCAGGGATCGATTGATATATTCAAGGACGCCGACACC
ACGAGAACCCGAGACTACTGGATTGCACCCAGTTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62