GenePrediction:GLEAN_3831 Details

Name: GLEAN_3831
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1182731..1183390 (+ strand)
Length: 660
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1182731..1182811 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_113:1183166..1183390 (+ strand)
Length: 225
>GLEAN_3831 class=GenePrediction position=GCSC_113:1182731..1183390 (+ strand)
ATGCACAATGCTGCCAAGCTCGCCTGTCCACAACAGGCCAAAGAATATAACAACGGCTTTCACGAGCACGGCAGCAGCCC
AGTATGCCCACTGGTTTAGCTTTATGTTGCGGACGTCGTTGGTGCTTATTGAAGATGCTAGTGGTGGCACTTAAAGGCAA
GAATATAATCGCAACAATGATAAAGGCATATATTGCGTTGTCGTGCCGGTCCTTCGTCGTGTCTCGTCGTGTCTGTTTTA
TTTCGGTTCTGTAAGGTGTCAAGGTAGAAACATCGATACTACGTAAGAAGTGCTGACGCCTCTTATCTTGCTCATAATCT
CTCATAATCTTTGTTTCCATCGGTCATAAGACATTGCACCCTACCCTGGAACCGGGCGGCTTGGACACATGTCGTCGGAG
AAGATCGCGGAACCGACAAGATCTCAGCCTACCAGGCACCATACCGGGCAGAGAGCCTCGCAGGCCTTCCGCCAGCTTAC
ATCGACGTCGGCGAGTGCGATGTGTTCCGCGATCCGGTCGTGGCCTACGCCACGAACATGTGGCGTTGTGGGTCTACATG
CGAGCTGCACGTCTGGCCAGGGGCATTCCACCTCTTCGACGGGATGGACAATCCCGACGTGCCGCTGATCCATGCGGCCA
TCAAGACGAAAAAGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62