GenePrediction:GLEAN_3833 Details

Name: GLEAN_3833
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1194130..1196370 (+ strand)
Length: 2241
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1194130..1194229 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_113:1194310..1195656 (+ strand)
Length: 1347
Type: CDS
Source: GLEAN
Position: GCSC_113:1195709..1196370 (+ strand)
Length: 662
>GLEAN_3833 class=GenePrediction position=GCSC_113:1194130..1196370 (+ strand)
ATGGACAGAGCGGGTGAAAGCAGGCAGAGCACAGCTTCGTCCGCCGCTCCTCCGGGGCCCAGACGGGCTCTGCGCAAGGG
CACACACAGCTGCGGCGAATGTAAGCAGGCGAACGCGGGATCTTGTGTTTGGACAGAGAACTGGAGAGCAAGCACTAAGA
CAGATTTTGCTGCACGATAGGCAAGAGGCGCAAGACGCGATGCTTCTTTGAGAGTCCGCGGGCAGTCAAATGTGTAGGCT
GCCAGCGTCGAGATACGGCCTGCATCAGCCAGGAGTACGTCGATGTGCCCTCGCAGGAGGTGCAGAAAGGGTCGAGCGTT
GCCGAGAGTCTTGGCCAGGTACAGCAGATGCTGCAACAGATCATGCGGAAGACGGCCGAAGAGGAGCAGGAGCAGAGGAA
GGTAGTCCAGGATGATCAACAGCAACAACAGCAACAGCAGCAACAGCATCAGACACCATTGGCAGACGTGCTGCAGGCAG
ACAACCCGTATGTGGACACGTGTCGGCGACTGCACGCGGCCCTTCCGTCGCAGGAGGATGTGCGGGTGCTCTTTGAGGCG
GGCCGGACACCCATCTACGTGCAGGCACTGTGCAATCCGTACGAAGAACTATTTGCCGAGGGCAAGGCGCGGTCGCTGGA
GGCGATGGCGGAGCTGCCGGCGGCGACGGCACACCCGACAATCCTGGCACGCAAGGTGCTTCACGTGGCGCTCTGTCTGC
AGCAGCTGGACCCAGGCTTCGATGCCGGGGCAGTGCAGCTTGGCCAGCCGGTCGGAGAAGCGATGCGGATGCTGTTTTCG
CTAGCAACGACAACGGTCACGTGCCACGACGAGCTGCTCGACTCGCTCGAGGGGCTAGAGTGTCTGGTCTGCGAGGCCGT
GTACCTGGTGAACAGCGGCAGTCTGCGGCGGGCGCTGTTGACGCTGCGACGAGCCTTGACGCTGGCACAGCTGATGGGCT
TCCATGCGACGCGACCAACACCCTGGACGCTGCGCCGGCTCGACGCGGCGACGCGGGTGTCGAGCGCGGTCACGTGGTCT
CATCTTGCGTGGCTCGAGCGATTCGTCGCTCTGCTGCTGGGACTGCCGACAGCGATCACGGGTGGCCCGACGGCACCGTT
GCAGCAGCCGGCCGACCAGACGGCCAGCGAGTGGATGGAGAGAGTGCAGGTAGACGTGTGTGGGCGCATCATGCGGCGAA
ACGAGGATCTGGCGCAGAGCCGAGAGAACAAAGACCTCGGCAGCGATGCCATCTATGCGACGACGCAGCAGATCGACCGT
GAGCTCAGTGCGATGGCTGAGAGCCTGCCGGCCGCATGGTGGAGCCCGCTGGACTTTCCGGCCGATAGGGTCCTGGACAT
CAGCGACATGATGGAGCGCATGATCAGTGCACAGATCCAGATCGTGCACTTCACCCTCGTGGCCCTGCTGCATCTGCCCT
ACCTCCTGCGCCAGCCGACCGGTCCGGACGGCCTGCACGTTTGCCTGTCGCGAGGTGCTCACGCGCTTCGTGCCGTTTCG
GGCACTCGTGCGCGTGGTTTATTGCTGCCGTCCGGTCGACTTCTGCGCCCTCACGGCAGCCCTCGTGCTGCTGGTGGCCC
ATCTGAGTGGCCAGCGTCACGCCGACTCCGGCTGGTTGTTGCCTCATCACCGTCGCGGCGACCGCGCCATCATGTCCAAG
GCTGTCGACACTATGGTCGAGCTCAGCCGGCTTAACGACGACGAGCTCTCGCGCCAGACCGCCGATCTCGCCCAGCGTCT
GCTCGATCTCGAGGCCCGCAGCACCAAGGACAGCCTTTGCTATAGTGCCACGGCCACGTTGGCCGACCCCCTCCTCGCTG
ACGACTCGCTGCTGCTGCAGATCCCCTACTTTGGGTCCATCCGTCTCGTCTGCGAGCCCACTGCCTCGCCGGCCTACTCC
GATATCTCGTCTGCCTCGTTCGAGCACAGCTACGTGTCTCTGCCCAACCTGCCGGCCTATGTGACCCATCTGCCGTCCTA
CGGCCAAGCCTTTGTCTCTGAGCCAGTCGACCAGCCACAGCCACAGTCGCTACGTCCGCTGTCGTTCCTCTGCTACGACC
CTGTCGTACCGCCCATCCCCGGAGAGGGAGACCCATTCGGACTCGATGTCGACATGCCCGACTTGATGGCTGGCACCGAT
GTCTGGGCCTTTCAGGGCGTCGACGGGACCATCTTTGAGAACCTCATGCGCGGTGCCAACTACCCCCCCAACCACCCCTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62