GenePrediction:GLEAN_3834 Details

Name: GLEAN_3834
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1196702..1198272 (+ strand)
Length: 1571
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1196702..1197064 (+ strand)
Length: 363
Type: CDS
Source: GLEAN
Position: GCSC_113:1197136..1198272 (+ strand)
Length: 1137
>GLEAN_3834 class=GenePrediction position=GCSC_113:1196702..1198272 (+ strand)
ATGACTACTACCAACACCTACTCGGAGACCAAGGTCCGTCCCACAGGATGGGAGTCCGCCCCAGACTCGGAGCGCTTCTC
CCTGTCCCACATGGGCCACATCATGCCCAAGATCTACGTTCTGATCGCCGAGGTCTTTTCCCTGCCGGAGCAGGCCGACA
AAGATGCCATTATCAAAAGCCTCGTTGCCGGATTGGAGTTTGCCCTGTCGCAGTTTCCCCTTCTCGTTGGTGCCTTGGAG
ATGGACGAAGCCAGCGGCCGTATGTGGGTGTCCAAGAAGAAGACGTCCACTCTGAGCCTGCACGTCAAGCATATGCTCTC
GACCGACGACTTCCCCTCCTACGATGAGCTGGCCAGGAAAGGCGTACGTATGCAGCCCAAGTGATCGTTTACGGGTAGAC
AAGCAGACACTAGCTCACAACCGTTCCGACACAGTTTCCCGCAAATCTGATCGCAGGCCACCAGCTGCTCCCCGAGTCCG
TCACCGCAAAGCAGCTGCACTCGCCCCTGGGCGACAACAGCCAAGAGGGCCTGGCCGTCGCCACGTTCCAGATCAACTTT
ATTGGCGGAGGCCTTATCCTCGGTGCCGCCGTACACCATTGCGTGTCCGACGGGCCCGGCTGCGATGGCTTCCTGACCAC
CTGGGCCCAGAACAGTGCGGCTGCTGCCGAGGGCAAATCCTTTGTGCCCATCACCCCGTTCCGGATTTCCGGCACGCCGC
TTGACGTGGCTGACCCGTCGCCCGATCGTATCGCTGACCTGGTCGCGGCCTATCCGGTCGTCAAGGATGCCGGCGGCCCA
ATGGCGCCGCCTCCAGCAGGCTTCCAGATGCCGGTCTTTTCGCAGCAAATGTGGCACTTTCCCCGCAGCAAGCTCGAGCA
GCTCAAGAAAGCGGCCTCGCCGAAGCAGACATCAACAGAAAGCACCCATGTCGACAACAACAGCAGCAGCAGCTGGGTCT
CCACGTACGACGCCATCGTGGCCCTTCTCTGGAGCGGCATCACGAGGGCCCGTATCGACCTCTTCCACCCAGACCCCGAG
ACCACGGCGCTGATGGTAAACGCGCTCGACACCCGTCGGATCTGGAAACCGCCACTGCCCGGACGCTTCCTCGGCGTCGG
TGCCGCGCCCGCCCGCTCCGAGCCCATCGCCATCCGCGACATCGTGCAGCTGCCCGACAATCTGCCGTGCCTCGCTGCGG
CCGTGCGCTCGTCCATCCGTGCCATGACCCCCCAATATGTCACCGGCCTGCTCGAATGGGTTGCCGGTCATCCCGACCGC
CGCTGGCTCGAGATCGACATTCGCTCCTTCTTGGGCATGGATCTCGCCGCCTCCAGCTGGCAGGGCATGTCCGCCTACTC
TCAGCACGACTTCGGCTTTGGCCTTCCCAGCGCCCTGCGCTGGCCCAGTCCGGCTATGGACGGCTTTGTCTTCCTCTATC
CCAGCCGTGCTGCCACCCCCGGCGCTGACCCCGATGAGGGCGTCGAGCTCTGCGTCTGTCTCGAGACCAGCTGCCAGCAG
CGCCTGCTCAAGGACGAGCAGGTTCTGCAGTTTGCCCACCCCAGAGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62