GenePrediction:GLEAN_3835 Details

Name: GLEAN_3835
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1199126..1200697 (+ strand)
Length: 1572
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1199126..1199284 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_113:1199354..1200697 (+ strand)
Length: 1344
>GLEAN_3835 class=GenePrediction position=GCSC_113:1199126..1200697 (+ strand)
ATGGCTCCATTACGCGCTACTCTCGACTACTATGACTACATGGGCATCGCACAAGATGCAGATGACAATCAGATCAAAGC
TGCATATAGACAGCTAGCAAAACTGTATCATCCGGACAGAAATCGTGGCAACGATGAGGCCAAGGCAAAGTTTCAGACGG
TATATGCTGTCCGAGGAAAGACTCGTTTCTCAGATACAAAGATGCTAATGATATTCCGGTAAATACAGCTCCAAGAAGCA
TACTCTATACTTATCGACATCGAAAAGCGCAGACAGTACAACCAAATCTACCCTTCCATCCGTACCAAATATGCCACCCC
GAAGGCCTCTGCCAATGACAGAGGCACAGCCCAGTGGGACAGCACCACAACGAAACCAGCGCAAGACAACGACGCGTCCT
TGCGAGTATTCCAGGAACAGCTTAGCACAATCGACAGAGAGCTGCAAGCCCTCTACCAGAGTCTTAACCGGACAAAAGGC
ACTTTGAAAGAGAGTCAGGGGTCCTTAGACGAGGTCTTAGCTGCTCTACAAAAGCTGGACTTGGAAGACAGAGAAGACGA
GGCCGCAGAAGTCTTAAGTAATGGTTGGTACAGCTACCTTTTTGGGGGACAAAAGTCGTCCGCTCAAGAAGAGGAAAGAA
AAAACAATAGAGCTAGGCGCCAGACGGAACGGCGGGTTGGGCGCCTCGTGCATGAATCTAAACGCTCAAGATGCAGGGAC
AATGTCAAAGGCCTACAGGGAACCTTGGCAGAGCTGGAAATTAAGGTCGAATTGAAGGAGGCACAACGGAAATTCGTTTT
GCGAAAACGCGAAGATGCTAAGCGTGCTGCTGAATGGGCTCGCGTATACGCAGAACAACAGGCCGCACGGCAGAAAAAGC
AAGAAGAAGCACAGAGAGCTCAGGAGGAGGAAAAAAAGGCCCAGGAGTGGTCCAGAAAACATCAAGAGGAGTCCAGAAGG
TTTGAAGAAGAGATCAGGAAATCCCAAGAGGACGCCTGGAAAGCACGAGCGGACGAGTTCAGGAAGCGCAGAGAGCGAGA
CGAGAAAGCTCGTAAGGAAAAAGACGAGAATGATCGCAGAGAGAGAGAAGAGAGGGTTCGCAAAGAAAACGCCGAGAAAG
CTCGCAAAGAAAGAATTGAAAAGGCCCGAAAAGAAAGCGAGGAGAGAGCTCGCAGGGAGAGAGAGGAGAGGCTACGCAAA
GAAAGAATTGAAAAGGCTCAAAAAGAAAGCCAGGGGAAAGCTCGCAGGGAGAGAGAGGAGACAGATCGCAGAGAGGCTGC
AATCTTAAATTCTGACCAGTGGTTGAAAAAGACCCGCGAAGCGAAGAAAGCACAGGAGGCTGAAGCAGCCCGACGATGGG
AGACAGACGTCCTGAAGGAGACCCGGAAGACAAATGGGAAGGGCAAGACCCCACACAGAGCGGCCGCTTGTTCGCATAAG
ACGTGGTGGATCAAGGTGGATGGTGGACACTTGTGCAAGCATTGCGAAGAGCTCACCTTTCGGTTCGCATACAAGTGTCC
TGACTGTCTGACAATGGCCTGTGCAGGTTGCATGCGCAGCTTGAAGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62