GenePrediction:GLEAN_3836 Details

Name: GLEAN_3836
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1202984..1207343 (+ strand)
Length: 4360
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1202984..1203208 (+ strand)
Length: 225
Type: CDS
Source: GLEAN
Position: GCSC_113:1203276..1203371 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_113:1203440..1203542 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_113:1203597..1203683 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_113:1203781..1203947 (+ strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_113:1204004..1204099 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_113:1204163..1204565 (+ strand)
Length: 403
Type: CDS
Source: GLEAN
Position: GCSC_113:1204623..1204971 (+ strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_113:1205267..1207343 (+ strand)
Length: 2077
>GLEAN_3836 class=GenePrediction position=GCSC_113:1202984..1207343 (+ strand)
ATGGATATTCAGCCGACAAAAAGGCAGAGTGTCGAGGACGACGCCTCGGTCATCAAGGCGTCCCTGGTAAGCGTCGGTCG
CGAGAACCTGGCACACACTCTTCCGCCACACGAGTCGTATGAAGGGCGGCATCGATGGGATGCCGAGATGACCTGGACGC
CGGAGGAAGAGCGATGGGTTGTGCGAAAGGCTGACATGTTTTTCCTGCCGATCCTTTGCTTGATGGTGAGTGCAGTCGTG
CTGGATTGCAGTTGAGGCCTGAAGTGTATGTCTTTGCTGACGGGAAATGCAGTTTTTCGGTCTCCAATTGGATCGGGGAA
ATCTGTCCAATGCCCTGGCAGACAATCTTTTAAAGGACCTGAAGATTAACAGCGACGACTACAACAACGTGAGTACGCTG
TGTACAAGCTCTGACCTGAATACAGCTAACATACAGGAAAGGGTACTACCATTCAGCTTGTCTGCTTTCTCGCTGCCGAG
TTCCCTGTTCAGATGCTCACGAAGCGGCTTGGCTTCAAATATGTGCTTCCGATAATGATGTTTTGCTGGAGCACTGTTTG
TATGTCATGTTTCGTCCATTCTTTCGAAAGGTTATACTGACCTTTCAACATAGCTTGGGCTCAGGCGTGGATGACCGATC
GGACTTCGTTTTACATCACGCGTGCGCTGATTGGCCTTTTTGAGGGTGGTTTCATTCCAGGTTGGTGCCCTATTTCTGCT
AAATTGTTTTGGCCGCCGTGTTCTAACGCCAGTGTAAGGCACAATTTTGTTTGCTACGTACTTCTACACGTCTCAAGAGC
TTTCTGTTCGACTTGCCGTGTTCTGGTCAACCCTGAACATTGCACGCGTAATCTCGGCACTTCTGGCAGCTGCCATTCTT
AAGATGCGAGGCATCGGCGGACATACAGGCTGGTTCTGGGCCTTTCTCCTGGAAGGCATTCTAACTGCCCTGATTTCCAT
TATTGTGAGTATATGAAGGACATGACAACCTGGTATCTGTTGCTGACAAAAACGCTCCAGGCTTTTCTGTACCTCCCCTC
GTCGCCGACGTCGACAAAGAGTTTCCTGTGGAGGAAGTCGTGGTACACGGAGCGTGAAGAGGCGATTATGGTTAACGTGA
GTTGGGCCCCCACGACGTCCCCTCTTGTCTACTGTCTTTAACCAGGGGATGATATACAGCGCATTCTCCGTGACGATCCA
GCCAAGGGACGTACCGCTTTGAAGGAGCCGGTGACGTGGCACGACATCAAGAGCGCGTGGTCGGACAAGTCGATGTGGGG
GCTGTACTTTATCGGGCTGGTGGCCTACATCCCGGCAACACCGGTGCAGGCGTATCTGACGCTGACGATCAAGCGGCTCG
GCTTCACGACGTTTGACGCGAACATGTTGACGATGCCGTCGGCCGGCATCCAGGTGGTGACCATGCTGGTGCTGGCATTC
AGCAGCGACTATTTCAACGAGCGGACGTTCCACTGTTTCTTCGGCGAGCTGTGGATCCTGCCGATGCTCATTGCTCTGCG
GACAATTCACGATGGCGGGCGGGATTGGTCGCGATTCACGCTGATCACGCTGACGTCTGGCTGTACGTTCCCATTTGTGC
TGCGAGTCTGCCTTTGCACATGCTGACAACTGTACGCAGACCCGTACTTCCACCCGATTGTATCGGCGTGGATCTCGGAA
AATACGTTTGACGTTAAGAAGCGGACGATCACGGCAGCTACGTACAATGTGGTCGTCCAGATCGGCTCTCTGATCGGGTC
GCAGATCTACCGCAAGTACGATGCGCCCTACTACAAACAGGGCAACACGGTGCTGCTGTCAATCTGTGCCTTGTCACTGG
TTGTGTTCATCGTGCAGCGACAGGTGCTGGTCCACCTTAACAAGAAGAAATCGGCCGTCTGGGACGTGATGTCGGCTGAG
GAGAAGACGGCGTATCAAGAAGACACGCTGTCACGTGAGAAGGAGGGCAACCGCCGGCTGGATTTCCGGTTTGTCTACTG
AAGAGGAAGGAGGAGAATGTTTCTGTACCAGCAGGAATAGAAAAATGCAAGTCTTACACAACACTTGCAGACGCACTAAG
CAGGAGCCAACGTAGCGCATCCAGGCTGCTGGGTAATAGTGGGGCCAGAGGGTTGCGCAATTGATGGTTCAGATGGCGCA
AGCGATAGCAGAGAACGTGCCGCGACCGATCTGGTGCGAGCAATGTGGTCAAACATCATGCAATGCACAACGGGGAAGGA
GACAGAGGACGGACAAGATCGAAGACGACCGGCGGATGCATAGCCTACCCATGCTGGCCGGTTACATGGCGCAACCGCTA
TCGATGCCCAAAACGACAGCCACTGGCCGAAAGATCGGCAGCAAGCGGGCCTGCGATGGCTGCAAGGTGCGCAAGGTGCG
CTGCTCGGGGGCGGTGCCCTGTGGCGGCTGTCGGGCGGCGGGCATGCCGTGCACGTTTCTGCGGAATCCGGCCGTCCGAG
GGCCGAAGAGCCTGCGGGCGAAGACGATGCTCCTCATCGCGAAGACGCAGCAGCATCAACAGCAAGAAGAGGAGCGAGAA
GGGGAACGACACGCAGAACGAGAACGAGAACAAGACGATGGAGAGCAGGGCTACGATGGAGGCAGTCCGATGGCAGATGA
TCGTCTACTGAGCAGTCTGGACACGGCCATAATGATATCAGAGACGGCAGCTGGCAACAAGACCCCGGTGCAGTCGCTGG
TGCTGGTGCTGTGCATCTTCCGGCTGCGCTTGTTTCCACTGTGGCCGATTGTGGATATTGAGGCGACCATGGCGTCGCTG
CACCACCGCAGCGACGAGGACAACGACGGGGAAGACGGCAGCAGCAGCAGCCTGGAGGCATATGCGCTGGCCAACAGCAT
CGGGGCAGCAACGGCAGCGCAGCTGAAGCTGACACAGACAGACGTCGGCAGCGATGCGGCAGCCATGGAGGCTGAGTGCC
AGCGGGCACGCATGGCGCTGCAGCGAGACGGCAGCCGAGAGCGGCCAGCAGGCATCGACACGGTCCGCATCTCGTTCTTC
CTGCACGTCTACCACGAGAACAAAGCGCCAGGCGGGACCGAGTCGCTGCTGTATCTTCGCGAGGCCATCACGCTGGCGCA
GATCCTGCAGCTGCGTCAGCAAGGGTCTCTGTCGTCATCGTCGTCCTCGTCTACGCGCGAGCGACAGACGTGGCAAAAGA
TCGTTGCACTGCTCTTTGTGACGGAGCGCGGCGTCGCCCTCCTGCACAAGCTTCCGGCCATCTTGCACTACGATATGCGG
CAACTGGACTTTGACGATGCCGACGATGCGACCCGCGTGCTGCCCGGCTTCCGCAAGCTTGTCGGGCTCTTCTGGATGCT
CGACCAGGCCGGCGCCTTTTCCATTCTGCAGCGGGCCAGTCCCGAGCCCGAGCCCGAACCCGAGTCCGAGTTTCAGTCCG
AGTTCCAGTCCGAGCTCACCATCTCCCATCGCGGCCGCCTAGCCCTTCTGCAGCAGCGGCTGCGTGATGTCGCTGTCGAG
TCGACCGTCGACAACGACGTCCAGACGGCCGACATCTGCGTCACCCGTCAGTGGATGCAGGCTGTCCTCTGGCATGCCTC
GTCTGCCATGCGGCCACGAGGTAGGTCCGTCAGCTCTGAACAGGCCACGTCCCTGTCCCATCCGGTCCAGATCGCCAGAC
GGTTTCTCCAGGCTATCGCCCGTCTGCCTAACACTGCCGTCGAGGCACACGGCCCAGCCATGGTGAGATACATAGAGGCC
TTTCTTCATCTGCAAGACAGCCCGCTGACCTCGCAGGAATACAAAATTTACGAATTGGCAAGAATCGTCCTCGATGCTGT
GGCTGCTGACTCAGCAGGCCTTCGCGACTCACTCGACATGACCCGAGATGTAGTGGTCCAGCTGCAGAAGAAGCTGGCGT
CGTATCGCGGCGGCAACAAGACGCTTCTGCTGCTCCTGCACACACGCACGCGCGACCTCCTGAGCGACAATCGCATTCAC
CACATCAGCTCGGATGGCTTGGCCGCCTACGACGGCAGCCCGCAGAGGCCAGCTGTCCTGTCCAGCCAGATGAGCCAGGT
GTATACGCTGCAAACAGAGCCGACAACCTCTGTCCGGTCTGCGACAGCCGAAAACGAGGACGACAACGATAGCCAGGACT
CGTGGTTTCACACCACTGCCTCGGCACCGTCACAGTCCCAGCAGATCAACGCCACGTACTTGACGGGGCAGCCTTTTCAG
GCCCCGACTACGGCCGTCGACGTGCTGCTGGCTAACAGTGCGTTGTGGGAGCCTTCAGGCATCTGGGACCTTGCAGGCGG
TACCGACATGATGGACTTTGACGCGTCGTCGGCCAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62