GenePrediction:GLEAN_3837 Details

Name: GLEAN_3837
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1209630..1210927 (+ strand)
Length: 1298
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1209630..1209727 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_113:1209789..1209811 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_113:1209873..1209939 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_113:1210005..1210650 (+ strand)
Length: 646
Type: CDS
Source: GLEAN
Position: GCSC_113:1210706..1210927 (+ strand)
Length: 222
>GLEAN_3837 class=GenePrediction position=GCSC_113:1209630..1210927 (+ strand)
ATGACCTGGCCAGAGCCAAGAAATACCGGCATGCTCTACCGCCGCCTGGGCAACTCAGGCCTGCACGTTTCCGTGCTTGG
TCTGGGGGGCTGGCTCACGTGAGTCGCCAATGACTTCCGTCTGCATCTGCATGCTGGCTGCGCTAACTGGATCTGGCAGT
TTCGGTGGACATGTCGACAACGGTTCGTATCTATATTCTGGCTGTCCTCCTGTCGGTCAGGCCGTGATCTAAACTGTGTC
CAGAAAAGACGGTGGCTTGCATGAAGCAGGCGTATGACTGCGGCATCAACTTTTTCGACACCGCCGAGAGGTAAGATGTG
ATGACTAAGCTGCTCGCAACAGCACAATGGCCCACCTGTTGACATGGGCTTGCAGCTATGCCGACGGCCAGAGCGAGGTA
GCCATGGGCGCTGCCATCCGGCAGCTCGGCTGGAAGCGCAACGACATTGTGGTCAGCACGAAGCTCAACTGGGGCGGGGC
CAACGGCGAAGTCTTGGTCAACAACCACGGCCTGTCCCGCAAGCACATCCTCGAAGGCCTGCGGGCATCGCTGGCGCGCC
TGCAGCTCGAGTACGTCGATATTGTGTACGCGCACCGGCCGGACCGGCTGACGCCGATGGAAGAGACCGTTCGGGCCTTT
AACCACGTCATCGAGCGCGGCTGGGCCCTCTACTGGGGCACGTCCGAATGGGGCGCCGATGAGATCGCCGAGGCCTGCGG
TGTCGCCCGTGAGCTGCACCTCATCGCTCCCGTGGTCGAGCAGCCGCAGTACAACCTGCTGGAGCGCCGCCGCGTCGAGG
GCGACTTTCAGCGCCTCTACGCCCGCTTCGGCACCGGCCTTACCGTCTTCAGTCCCATCAAGATGGGACTGCTCAGCGGC
AAGTATAACGACTCGCCCGATGCCCCGCCTCCTGGCTCGCGCTTCGCCGAGAGCCACGACCGCTTCAGCAACCTGGTGCG
TGACTCCTGGTACGGCAACGACGAGTGGAAGTCCAACATCGCCAAGGTCATCCAACTCAAGGTTCGTCTTCTTCTTCTGC
TCCTCTCATCTACTCTCCACAACGCTGATCGTCCAGCCCATTGCCGATCGGCTCGCCGTAACCCAGTCCCAGCTCGCTCT
GGCCTGGTGCCTCAAGAACGAGCACGTGACCTCCGTCATCACGGGCGCATCAAAGCCCGAGCAGATCGTCGAGAATGTCC
AGGCCATCAAGATACTCGACAAGCTCACGCCCGAGGTGCTGGCCGAGATCGACGCCATCGTTGGAAAAGTCGAGCTGGAC
CCGGCACGGCAGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62